Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sarcophilus harrisii (Tasmanian devil) Sha-Mir-23-P3_3p (mature (guide)) URS0000391DB6_9305

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUCACAUUGCCAGGGAUUUCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Alligator mississippiensis ami-miR-23a-3p
    2. Bos taurus (cattle) bta-miR-23a
    3. Callithrix jacchus cja-miR-23a
    4. Danio rerio (zebrafish) dre-miR-23a-3p
    5. Gadus morhua (Atlantic cod) gmo-miR-23a-3p
    6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-23a
    7. Hippoglossus hippoglossus hhi-miR-23a
    8. Homo sapiens (human) Hsa-Mir-23-P1_3p (mature (guide))
    9. Latimeria chalumnae (coelacanth) Lch-Mir-23-P1_3p (mature (guide))
    10. Maylandia zebra mze-miR-23a
    11. Microcaecilia unicolor Mun-Mir-23-P3f_3p (mature (guide))
    12. Monopterus albus Mal-Mir-23-P1_3p (mature (guide))
    13. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72415
    14. Neolamprologus brichardi nbr-miR-23a
    15. Ophiophagus hannah oha-miR-23a-3p
    16. Oreochromis niloticus oni-miR-23a
    17. Ornithorhynchus anatinus (platypus) oan-miR-23a-3p
    18. Oryzias latipes ola-miR-23a
    19. Otolemur garnettii oga-miR-23a
    20. Ovis aries oar-miR-23a
    21. Pteropus alecto (black flying fox) pal-miR-23a-3p
    22. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62943
    23. Taeniopygia guttata Tgu-Mir-23-P3_3p (mature (guide))
    24. Takifugu rubripes fru-miR-23a
    25. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-23a
    26. Tor tambroides miR-23a-3p
    27. Xenopus laevis xla-miR-23a-3p