v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-23a-3p URS0000391DB6_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (ENA, RefSeq, miRBase, MirGeneDB). Danio rerio (zebrafish) dre-miR-23a-3p sequence is a product of miR-23a-3p, dre-miR-23a-3p, mir23a-1, dre-miR-23a, mir23a-3, miR-23a, mir23a-2, miR-23 genes. Found in the Danio rerio reference genome.

mRNA interactions 3 total

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    AUCACAUUGCCAGGGAUUUCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 27 other species

    1. Alligator mississippiensis (American alligator) ami-miR-23a-3p
    2. Anolis carolinensis Aca-Mir-23-P1_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-23a
    4. Callithrix jacchus cja-miR-23a
    5. Canis lupus familiaris Cfa-Mir-23-P1_3p (mature (guide))
    6. Cavia porcellus (domestic guinea pig) Cpo-Mir-23-P1_3p (mature (guide))
    7. Chrysemys picta bellii Cpi-Mir-23-P1_3p (mature (guide))
    8. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-23-P1_3p (mature (guide))
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-23-P1_3p (mature (guide))
    10. Gadus morhua (Atlantic cod) gmo-miR-23a-3p
    11. Haplochromis burtoni abu-miR-23a
    12. Hippoglossus hippoglossus hhi-miR-23a
    13. Homo sapiens (human) Hsa-Mir-23-P1_3p (mature (guide))
    14. Latimeria chalumnae (coelacanth) Lch-Mir-23-P1_3p (mature (guide))
    15. Macaca mulatta Mml-Mir-23-P1_3p (mature (guide))
    16. Maylandia zebra (zebra mbuna) mze-miR-23a
    17. Microcaecilia unicolor Mun-Mir-23-P3f_3p (mature (guide))
    18. Monodelphis domestica Mdo-Mir-23-P1_3p (mature (guide))
    19. Monopterus albus Mal-Mir-23-P1_3p (mature (guide))
    20. Mus musculus Mus_musculus piRNA piR-mmu-72415
    21. Neolamprologus brichardi nbr-miR-23a
    22. Ophiophagus hannah (king cobra) oha-miR-23a-3p
    23. Oreochromis niloticus oni-miR-23a
    24. Ornithorhynchus anatinus (platypus) oan-miR-23a-3p
    25. Oryzias latipes ola-miR-23a
    26. Otolemur garnettii oga-miR-23a
    27. Ovis aries (sheep) oar-miR-23a
    28. Pteropus alecto pal-miR-23a-3p
    29. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62943
    30. Sarcophilus harrisii Sha-Mir-23-P3_3p (mature (guide))
    31. Taeniopygia guttata Tgu-Mir-23-P3_3p (mature (guide))
    32. Takifugu rubripes (torafugu) fru-miR-23a
    33. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-23a
    34. Tor tambroides miR-23a-3p
    35. Xenopus laevis (African clawed frog) xla-miR-23a-3p
    36. Xenopus tropicalis Xtr-Mir-23-P3_3p (mature (guide))
     Publications