Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-23a-3p URS0000391DB6_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 5 databases (RefSeq, miRBase, PSICQUIC, ENA, MirGeneDB). Described in 14 papers. Danio rerio (zebrafish) dre-miR-23a-3p sequence is a product of dre-miR-23a, mir23a-3, miR-23a-3p, miR-23a, mir23a-1, miR-23, mir23a-2, dre-miR-23a-3p genes. Found in the zebrafish reference genome.

Interactions 6

According to PSICQUIC, Danio rerio (zebrafish) dre-miR-23a-3p interacts with:

Interaction id Participant Synonyms
URS0000391DB6_7955-0 A3KPQ7 A3KPQ7
URS0000391DB6_7955-3 A3KPQ7 A3KPQ7
URS0000391DB6_7955-1 Q9DG41 Q9DG41
URS0000391DB6_7955-4 Q9DG41 Q9DG41
URS0000391DB6_7955-2 Q9I903 Q9I903
URS0000391DB6_7955-5 Q9I903 Q9I903

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUCACAUUGCCAGGGAUUUCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 65 other species

    1. Alligator mississippiensis ami-miR-23a-3p
    2. Anolis carolinensis Aca-Mir-23-P1_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-23a
    4. Callithrix jacchus cja-miR-23a
    5. Canis lupus familiaris Cfa-Mir-23-P1_3p (mature (guide))
    6. Cavia porcellus (domestic guinea pig) Cpo-Mir-23-P1_3p (mature (guide))
    7. Chrysemys picta bellii Cpi-Mir-23-P1_3p (mature (guide))
    8. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-23-P1_3p (mature (guide))
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-23-P1_3p (mature (guide))
    10. Gadus morhua gmo-miR-23a-3p
    11. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-23a
    12. Hippoglossus hippoglossus hhi-miR-23a
    13. Homo sapiens Hsa-Mir-23-P1_3p (mature (guide))
    14. Macaca mulatta Mml-Mir-23-P1_3p (mature (guide))
    15. Maylandia zebra mze-miR-23a
    16. Monodelphis domestica Mdo-Mir-23-P1_3p (mature (guide))
    17. Mus musculus (house mouse) Mmu-Mir-23-P1_3p (mature (guide))
    18. Neolamprologus brichardi nbr-miR-23a
    19. Ophiophagus hannah oha-miR-23a-3p
    20. Oreochromis niloticus oni-miR-23a
    21. Ornithorhynchus anatinus oan-miR-23a-3p
    22. Oryzias latipes (Japanese medaka) ola-miR-23a
    23. Otolemur garnettii oga-miR-23a
    24. Ovis aries oar-miR-23a
    25. Pteropus alecto pal-miR-23a-3p
    26. Rattus norvegicus Rno-Mir-23-P1_3p (mature (guide))
    27. Sarcophilus harrisii Sha-Mir-23-P1_3p (mature (guide))
    28. Takifugu rubripes (torafugu) fru-miR-23a
    29. Tetraodon nigroviridis tni-miR-23a
    30. Tor tambroides miR-23a-3p
    31. Xenopus laevis (African clawed frog) xla-miR-23a-3p
    32. Xenopus tropicalis Xtr-Mir-23-P3_3p (mature (guide))