Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (LncBase, ENA, MirGeneDB, RefSeq, PirBase, TarBase, miRBase). Mus musculus (house mouse) mmu-miR-363-3p sequence is a product of miR-363-3p, mmu-miR-363-3p, Mir363, miR-363, mmu-miR-363 genes. Found in the Mus musculus reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1110051N18Rik, 2210415D20Rik, 2400008B06Rik, 6130401J04Rik, AP162, B2, Ctcf, D16Jhu32e, D330036J23Rik, E030002B02Rik.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AAUUGCACGGUAUCCAUCUGUA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.