Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-206 precursor secondary structure diagram

Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-206 precursor URS0000389B41_9600

Automated summary: This pre miRNA sequence is 86 nucleotides long and is found in Pongo pygmaeus. Annotated by 2 databases (ENA, miRBase). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-1, RF00103).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGCUUCCCGAGGCCACAUGCUUCUUUAUAUCCCCAUAUGGAUUACUUUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCGGCAAGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Cercocebus atys (Sooty mangabey) miRNA
    2. Chlorocebus sabaeus (African green monkey) miRNA
    3. Colobus angolensis palliatus microRNA 206
    4. Gorilla gorilla gorilla (Western Lowland Gorilla) miRNA
    5. Homo sapiens microRNA hsa-mir-206 precursor
    6. Macaca fascicularis miRNA
    7. Macaca mulatta microRNA mml-mir-206 precursor
    8. Macaca nemestrina microRNA mne-mir-206 precursor
    9. Mandrillus leucophaeus (Drill) miRNA
    10. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    11. Pan paniscus (bonobo) miRNA
    12. Pan troglodytes (chimpanzee) ptr-mir-206
    13. Papio anubis (Olive baboon) miRNA
    14. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 206
    15. Pongo abelii microRNA 206
    16. Rhinopithecus bieti miRNA
    17. Rhinopithecus roxellana microRNA 206
    18. Saimiri boliviensis boliviensis miRNA
    19. Theropithecus gelada microRNA 206
    2D structure New