Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548k URS000038718E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548k: Hsa-mir-548k is a microRNA that has been identified as one component of a seven-miRNA panel [PMC8582539]. It has been found to have higher expression in 3p arm loss, which is associated with poorer overall survival [PMC8582539]. Studies have shown that hsa-mir-548k enhances malignant phenotypes and tumor progression in esophageal cancer [PMC8582539]. It has also been identified as one of the differentially expressed miRNAs in the intersection of DEG targets [PMC8503613]. In sepsis, hsa-mir-548k has been found to potentially regulate prognosis, along with other lncRNAs and miRNAs [PMC9976425]. Hsa-mir-548k expression has been observed to be higher in cellular samples compared to FF samples [PMC8501715]. Lentiviruses for overexpression and inhibition of hsa-mir-548k have been used in experiments [PMC6775607]. Hsa-mir-548k has also been validated as being in the same direction of effect in different studies [PMC8073146]. It is one of the miRNAs used to calculate a risk score for cancer prognosis prediction, along with other clinical features [PMC8176021]. Hsa-mir-548k has also been found to target several pRS-related mRNAs and is associated with satisfactory K-M curves performance [PMC8176413]. In HPV-negative groups, hsa-miR-135b-3p, hsa-miR-605-5p, hsa-miR-383-5p, hsa-miR518a5p, hsa-miR1911 5p and hsa mir 548k were used for risk score calculation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGUACUUGCGGAUUUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-548k
Publications