Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) Bta-Mir-133-P1-v2_5p* (star (passenger)) URS0000383E7F_9913

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 18 other species
  • miRNA

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCUGGUAAAAUGGAACCAAAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Alligator mississippiensis ami-miR-133a-5p
    2. Anolis carolinensis Aca-Mir-133-P1-v2_5p* (star (passenger))
    3. Canis lupus familiaris Cfa-Mir-133-P1-v2_5p* (star (passenger))
    4. Capra hircus chi-miR-133a-5p
    5. Cavia porcellus (domestic guinea pig) Cpo-Mir-133-P1-v2_5p* (star (passenger))
    6. Chiloscyllium plagiosum microRNA cpl-miR-133-5p
    7. Chrysemys picta bellii Cpi-Mir-133-P1-v2_5p* (star (passenger))
    8. Chrysemys picta cpi-miR-133a-5p
    9. Columba livia (rock pigeon) Cli-Mir-133-P1-v2_5p* (star (passenger))
    10. Danio rerio (zebrafish) dre-miR-133a-5p
    11. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-133-P1-v2_5p* (star (passenger))
    12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P2-v2_5p* (star (passenger))
    13. Gadus morhua gmo-miR-133a-5p
    14. Gallus gallus Nc-gga-miR-133a* microRNA
    15. Homo sapiens (human) hsa-miR-133a-5p
    16. Macaca mulatta (Rhesus monkey) mml-miR-133c-5p
    17. Monodelphis domestica mdo-miR-133a-1-5p
    18. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49145126
    19. Ornithorhynchus anatinus oan-miR-133a-5p
    20. Oryctolagus cuniculus (rabbit) Ocu-Mir-133-P2-v2_5p* (star (passenger))
    21. Pteropus alecto (black flying fox) pal-miR-133a-5p
    22. Python bivittatus (Burmese python) pbv-miR-133a-5p
    23. Rattus norvegicus (Norway rat) rno-miR-133a-5p
    24. Sarcophilus harrisii Sha-Mir-133-P2-v2_5p* (star (passenger))
    25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-133-P1-v2_5p* (star (passenger))
    26. Sus scrofa (pig) ssc-miR-133a-5p
    27. Taeniopygia guttata (zebra finch) tgu-miR-133-5p
    28. Tor tambroides (Thai mahseer) miR-133a-5p
    29. Xenopus tropicalis Xtr-Mir-133-P1-v2_5p* (star (passenger))