Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3662 URS00003808EC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3662: Hsa-mir-3662 is a circulating miRNA that has been identified in various types of cancers, including lung adenocarcinoma and hepatocellular carcinoma [PMC7012856] [PMC8781987] [PMC4757586]. It has been suggested as a potential biomarker for the diagnosis of lung adenocarcinoma [PMC8781987]. Hsa-mir-3662 has also been found to be overexpressed in patients with SI tumor, indicating its potential to distinguish this group of patients from others [PMC9776661]. In addition, hsa-mir-3662 has been shown to have a significant effect on prognosis in cancer patients [PMC9389359]. It is one of the miRNAs that are often packed in extracellular vesicles, specifically exosomes [PMC7012856]. Hsa-mir-3662 is also known to have binding sites on certain genes, such as RORA and CD14, suggesting its regulatory role in gene expression [PMC8029983] [PMC9526608]. Furthermore, hsa-mir-3662 has been found to be associated with other miRNAs such as hsa-miR-144 and hsa-miR-3646, which have a high number of target genes in coexpression networks [PMC9461120]. Overall, hsa-mir-3662 is an important circulating miRNA that shows potential as a diagnostic biomarker and prognostic indicator in various types of cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAAAUGAUGAGUAGUGACUGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications