Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-519c-3p URS000037D7E5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-519c: Hsa-mir-519c is a microRNA that decreases endogenous ABCG2 mRNA and protein levels by binding to a specific site in the longer 3UTR region of parental cells [PMC8259352]. Hsa-mir-519c belongs to a group of miRNAs, including hsa-mir-372, hsa-mir-373, and hsa-mir-520c, that share a strong seed sequence homology [PMC5311252]. The 3' untranslated region truncation of ABCG2 removes the hsa-mir-519c binding site and leads to increased expression of ABCG2 [PMC5404803]. The F142 residue in ABCG2 is analogous to the ΔF508 mutation in the cystic fibrosis transmembrane receptor and is located in a mutational "hot spot" region [PMC5404803]. Hsa-mir-519c is one of several miRNAs that are involved in the transition from induced pluripotent stem cells (iPSC) to neural stem cells (NSC) [PMC6696086]. The expression levels of hsa-miR-512, hsa-miR-516b, hsa-miR-518e, hsa-mir-519c, and hsa-miR-523 are significantly decreased in NSC cells compared to iPSC [PMC6696086]. Hsa-miR-512, hsa-miR516b, hsa-miR517a,b,h sa miRNA518e,h sa mirRNA519c,h sa miRNA523 are believed to be negative regulators of neural differentiation from iPSCs [PMC6696086]. A polymorphism C421A in the ABCG2 gene affects the expression level of ABCG2 protein and individual efficacy of antineoplastic drugs by influencing the regulatory role of hsa-mir-519c [PMC5539293]. Genetic variations in ABCG2, including the C421A polymorphism, can also affect the protein expression and individual efficacy of antineoplastic drugs through the regulatory role of hsa-mir-519c [PMC8871547].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGUGCAUCUUUUUAGAGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes (chimpanzee) ptr-miR-519c
Publications