Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) Cfa-Mir-144-v2_3p (mature (guide)) URS000037C5A8_9615

  • 20 nucleotides
  • 1 database (MirGeneDB)
  • Found in 14 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGUAUAGAUGAUGUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Anolis carolinensis aca-miR-144-3p
  2. Artibeus jamaicensis aja-miR-144
  3. Danio rerio (zebrafish) dre-miR-144-3p
  4. Equus caballus (horse) eca-miR-144
  5. Homo sapiens (human) hsa-miR-144-3p
  6. Macaca mulatta (Rhesus monkey) mml-miR-144
  7. Mus musculus (house mouse) mmu-miR-144-3p
  8. Ornithorhynchus anatinus (platypus) oan-miR-144-3p
  9. Python bivittatus pbv-miR-144-3p
  10. Rattus norvegicus (Norway rat) rno-miR-144-3p
  11. Taeniopygia guttata tgu-miR-144-3p
  12. Takifugu rubripes fru-miR-144
  13. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-144
  14. Tor tambroides (Thai mahseer) miR-144-3p