Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-144-3p URS000037C5A8_7955

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Danio rerio. Annotated by 3 databases (ENA, RefSeq, miRBase). Described in 17 papers. Danio rerio (zebrafish) dre-miR-144-3p sequence is a product of dre-miR-144-3p, mir144, miR-144-3p, dre-miR-144, miR-144 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACAGUAUAGAUGAUGUACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Anolis carolinensis aca-miR-144-3p
    2. Artibeus jamaicensis aja-miR-144
    3. Bos taurus Bta-Mir-144-v2_3p (mature (guide))
    4. Canis lupus familiaris (dog) Cfa-Mir-144-v2_3p (mature (guide))
    5. Equus caballus (horse) eca-miR-144
    6. Homo sapiens hsa-miR-144-3p
    7. Macaca mulatta (Rhesus monkey) mml-miR-144
    8. Mus musculus mmu-miR-144-3p
    9. Ornithorhynchus anatinus (platypus) oan-miR-144-3p
    10. Oryctolagus cuniculus (rabbit) Ocu-Mir-144-v2_3p (mature (guide))
    11. Python bivittatus pbv-miR-144-3p
    12. Rattus norvegicus (Norway rat) rno-miR-144-3p
    13. Taeniopygia guttata tgu-miR-144-3p
    14. Takifugu rubripes fru-miR-144
    15. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-144
    16. Tor tambroides miR-144-3p