Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-144-3p URS000037C5A8_10116

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Rattus norvegicus. Annotated by 3 databases (PirBase, miRBase, RefSeq). Described in 19 papers. Rattus norvegicus (Norway rat) rno-miR-144-3p sequence is a product of miR-144-3p, miR-144, rno-miR-144-3p, rno-miR-144, Mir144 genes. Found in the norway rat reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACAGUAUAGAUGAUGUACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Anolis carolinensis aca-miR-144-3p
    2. Artibeus jamaicensis aja-miR-144
    3. Bos taurus Bta-Mir-144-v2_3p (mature (guide))
    4. Canis lupus familiaris (dog) Cfa-Mir-144-v2_3p (mature (guide))
    5. Danio rerio dre-miR-144-3p
    6. Equus caballus (horse) eca-miR-144
    7. Homo sapiens hsa-miR-144-3p
    8. Macaca mulatta (Rhesus monkey) mml-miR-144
    9. Mus musculus mmu-miR-144-3p
    10. Ornithorhynchus anatinus (platypus) oan-miR-144-3p
    11. Oryctolagus cuniculus (rabbit) Ocu-Mir-144-v2_3p (mature (guide))
    12. Python bivittatus pbv-miR-144-3p
    13. Taeniopygia guttata tgu-miR-144-3p
    14. Takifugu rubripes fru-miR-144
    15. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-144
    16. Tor tambroides miR-144-3p