Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-144-3p URS000037C5A8_10090

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Mus musculus. Annotated by 6 databases (LncBase, miRBase, TarBase, PirBase, ENA, RefSeq). Described in 38 papers. Mus musculus (house mouse) mmu-miR-144-3p sequence is a product of miR-144-3p, mmu-miR-144, Mir144, mmu-miR-144-3p, miR-144 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610008P16Rik, 1110001A12Rik, 1110008J21Rik, 1110013H04Rik, 1110020D10Rik, 1110029F20Rik, 1110046H03Rik, 1110062K04Rik, 1200014D02Rik, 1200015P13Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACAGUAUAGAUGAUGUACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Anolis carolinensis aca-miR-144-3p
    2. Artibeus jamaicensis aja-miR-144
    3. Bos taurus Bta-Mir-144-v2_3p (mature (guide))
    4. Canis lupus familiaris (dog) Cfa-Mir-144-v2_3p (mature (guide))
    5. Danio rerio dre-miR-144-3p
    6. Equus caballus (horse) eca-miR-144
    7. Homo sapiens hsa-miR-144-3p
    8. Macaca mulatta (Rhesus monkey) mml-miR-144
    9. Ornithorhynchus anatinus (platypus) oan-miR-144-3p
    10. Oryctolagus cuniculus (rabbit) Ocu-Mir-144-v2_3p (mature (guide))
    11. Python bivittatus pbv-miR-144-3p
    12. Rattus norvegicus (Norway rat) rno-miR-144-3p
    13. Taeniopygia guttata tgu-miR-144-3p
    14. Takifugu rubripes fru-miR-144
    15. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-144
    16. Tor tambroides miR-144-3p