Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-92a-3p URS00003768C5_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (PSICQUIC, RefSeq, IntAct, TarBase, LncBase, GeneCards, MalaCards, miRBase, MirGeneDB, ENA). Described in 101 papers. Homo sapiens (human) hsa-miR-92a-3p sequence is a product of miR-92, MIR92A2, hsa-miR-92a-3p, miR-92a, 92, MIR92A1, hsa-miR-92a, miR-92a-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 13CDNA73, 156DAG, 16.3A5, 16E1BP, 1700010H15RiK, 182-FIP, 18A2, 2HOR0202, 42A, 6A3-5.

Interactions 74

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-92a-3p interacts with:

Interaction id Participant Synonyms
EBI-21020265 intact:EBI-21019827 EBI-21019827 ENST00000297338 mrna_rad21
URS00003768C5_9606-0 O15539 O15539
URS00003768C5_9606-38 O15539 O15539
URS00003768C5_9606-1 O43474 O43474
URS00003768C5_9606-39 O43474 O43474
URS00003768C5_9606-2 O43474 O43474
URS00003768C5_9606-4 O43521 O43521
URS00003768C5_9606-3 O43521 O43521
URS00003768C5_9606-41 O43521 O43521
URS00003768C5_9606-40 O43521 O43521
URS00003768C5_9606-5 O75159 O75159
URS00003768C5_9606-42 O75159 O75159
URS00003768C5_9606-43 O95980 O95980
URS00003768C5_9606-36 O95980 O95980
URS00003768C5_9606-6 P08648 P08648
URS00003768C5_9606-44 P08648 P08648
URS00003768C5_9606-8 P12830 P12830
URS00003768C5_9606-45 P12830 P12830
URS00003768C5_9606-7 P12830 P12830
URS00003768C5_9606-46 P35398 P35398
URS00003768C5_9606-9 P35398 P35398
URS00003768C5_9606-47 P46782 P46782
URS00003768C5_9606-10 P46782 P46782
URS00003768C5_9606-48 P60484 P60484
URS00003768C5_9606-37 P60484 P60484
URS00003768C5_9606-11 P98175 P98175
URS00003768C5_9606-49 P98175 P98175
URS00003768C5_9606-50 Q12931 Q12931
URS00003768C5_9606-12 Q12931 Q12931
URS00003768C5_9606-51 Q15691 Q15691
URS00003768C5_9606-13 Q15691 Q15691
URS00003768C5_9606-14 Q17RY0 Q17RY0
URS00003768C5_9606-52 Q17RY0 Q17RY0
URS00003768C5_9606-53 Q7Z5Q1 Q7Z5Q1
URS00003768C5_9606-15 Q7Z5Q1 Q7Z5Q1
URS00003768C5_9606-16 Q86SE9 Q86SE9
URS00003768C5_9606-54 Q86SE9 Q86SE9
URS00003768C5_9606-17 Q8N5Y2 Q8N5Y2
URS00003768C5_9606-55 Q8N5Y2 Q8N5Y2
URS00003768C5_9606-56 Q8NDI1 Q8NDI1
URS00003768C5_9606-18 Q8NDI1 Q8NDI1
URS00003768C5_9606-57 Q8NE35 Q8NE35
URS00003768C5_9606-19 Q8NE35 Q8NE35
URS00003768C5_9606-58 Q8TF40 Q8TF40
URS00003768C5_9606-20 Q8TF40 Q8TF40
URS00003768C5_9606-59 Q8WZ73 Q8WZ73
URS00003768C5_9606-21 Q8WZ73 Q8WZ73
URS00003768C5_9606-60 Q92731 Q92731
URS00003768C5_9606-22 Q92731 Q92731
URS00003768C5_9606-23 Q92830 Q92830
URS00003768C5_9606-61 Q92830 Q92830
URS00003768C5_9606-24 Q96I15 Q96I15
URS00003768C5_9606-62 Q96I15 Q96I15
URS00003768C5_9606-25 Q96MG8 Q96MG8
URS00003768C5_9606-63 Q96MG8 Q96MG8
URS00003768C5_9606-64 Q9BZF1 Q9BZF1
URS00003768C5_9606-26 Q9BZF1 Q9BZF1
URS00003768C5_9606-27 Q9H1P3 Q9H1P3
URS00003768C5_9606-65 Q9H1P3 Q9H1P3
URS00003768C5_9606-28 Q9HCD6 Q9HCD6
URS00003768C5_9606-66 Q9HCD6 Q9HCD6
URS00003768C5_9606-29 Q9UBP4 Q9UBP4
URS00003768C5_9606-67 Q9UBP4 Q9UBP4
URS00003768C5_9606-68 Q9UGQ2 Q9UGQ2
URS00003768C5_9606-30 Q9UGQ2 Q9UGQ2
URS00003768C5_9606-31 Q9UJF2 Q9UJF2
URS00003768C5_9606-69 Q9UJF2 Q9UJF2
URS00003768C5_9606-34 Q9Y5W3 Q9Y5W3
URS00003768C5_9606-33 Q9Y5W3 Q9Y5W3
URS00003768C5_9606-32 Q9Y5W3 Q9Y5W3
URS00003768C5_9606-70 Q9Y5W3 Q9Y5W3
URS00003768C5_9606-71 Q9Y5W3 Q9Y5W3
URS00003768C5_9606-72 Q9Y6W6 Q9Y6W6
URS00003768C5_9606-35 Q9Y6W6 Q9Y6W6

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUUGCACUUGUCCCGGCCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 126 other species

    1. Alligator mississippiensis ami-miR-92a-3p
    2. Anolis carolinensis aca-miR-92a
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-92
    4. Bos taurus (cattle) bta-miR-92a
    5. Callithrix jacchus cja-miR-92a
    6. Callorhinchus milii (elephant shark) eshark_mir-25_3
    7. Canis lupus familiaris cfa-miR-92a
    8. Capra hircus chi-miR-92b
    9. Cavia porcellus (domestic guinea pig) cpo-miR-92a-3p
    10. Cervus elaphus (red deer) cel-miR-92a
    11. Chrysemys picta bellii Cpi-Mir-92-P1b_3p (mature (guide))
    12. Columba livia (rock pigeon) cli-miR-92-3p
    13. Cricetulus griseus cgr-miR-92a-3p
    14. Cyprinus carpio ccr-miR-92a
    15. Danio rerio (zebrafish) dre-miR-92a-3p
    16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-92a-3p
    17. Daubentonia madagascariensis (aye-aye) dma-miR-92a
    18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-92-P1b_3p (mature (guide))
    19. Equus caballus (horse) eca-miR-92a
    20. Gallus gallus (chicken) Gga-Mir-92-P1b_3p (mature (guide))
    21. Gorilla gorilla (western gorilla) ggo-miR-92
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-92a
    23. Ictalurus punctatus (channel catfish) ipu-miR-92a
    24. Lagothrix lagotricha lla-miR-92
    25. Lemur catta lca-miR-92
    26. Macaca mulatta mml-miR-92a-3p
    27. Macaca nemestrina (pig-tailed macaque) mne-miR-92
    28. Maylandia zebra mze-miR-92a
    29. Microcebus murinus mmr-miR-92a
    30. Monodelphis domestica mdo-miR-92a-3p
    31. Mus musculus (house mouse) Mmu-Mir-92-P1a_3p (mature (guide))
    32. Neolamprologus brichardi nbr-miR-92a
    33. Nomascus leucogenys nle-miR-92a
    34. Ophiophagus hannah oha-miR-92a
    35. Oreochromis niloticus oni-miR-92a
    36. Ornithorhynchus anatinus oan-miR-92a-3p
    37. Oryctolagus cuniculus (rabbit) ocu-miR-92a-3p
    38. Otolemur garnettii oga-miR-92a
    39. Pan paniscus ppa-miR-92a
    40. Pan troglodytes (chimpanzee) ptr-miR-92
    41. Papio hamadryas (hamadryas baboon) pha-miR-92a
    42. Penaeus japonicus miR-92a
    43. Pongo pygmaeus ppy-miR-92
    44. Pteropus alecto pal-miR-92a-3p
    45. Pundamilia nyererei pny-miR-92
    46. Python bivittatus pbv-miR-92a-3p
    47. Rattus norvegicus Rno-Mir-92-P1a_3p (mature (guide))
    48. Saguinus labiatus sla-miR-92
    49. Saimiri boliviensis boliviensis sbo-miR-92a
    50. Salmo salar (Atlantic salmon) ssa-miR-92a-3p
    51. Sarcophilus harrisii Sha-Mir-92-P1b_3p (mature (guide))
    52. Scyliorhinus torazame (cloudy catshark) Sto-Mir-92-P1b_3p (mature (guide))
    53. Sus scrofa ssc-miR-92a
    54. Taeniopygia guttata (zebra finch) tgu-miR-92-3p
    55. Takifugu rubripes (torafugu) fru-miR-92
    56. Tetraodon nigroviridis tni-miR-92
    57. Tor tambroides miR-92a-3p
    58. Tupaia chinensis tch-miR-92a-3p
    59. Xenopus laevis (African clawed frog) xla-miR-92a-3p
    60. Xenopus tropicalis Xtr-Mir-92-P1b_3p (mature (guide))