Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-92a-3p URS00003768C5_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (ENA, RefSeq, miRBase, MirGeneDB). Described in 21 papers. Danio rerio (zebrafish) dre-miR-92a-3p sequence is a product of miR-92a, mir92a-2, mir92a-1, miR-92, miR-92a-3p, dre-miR-92a-3p, dre-miR-92a genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUUGCACUUGUCCCGGCCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 538 other species

    1. Alligator mississippiensis ami-miR-92a-3p
    2. Anolis carolinensis (green anole) aca-miR-92a
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-92
    4. Bos taurus (cattle) bta-miR-92a
    5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-92a
    6. Callorhinchus milii Cmi-Mir-92-P1c_3p (mature (guide))
    7. Canis lupus familiaris (dog) cfa-miR-92a
    8. Capra hircus chi-miR-92b
    9. Cavia porcellus cpo-miR-92a-3p
    10. Cervus elaphus cel-miR-92a
    11. Chrysemys picta bellii Cpi-Mir-92-P1a_3p (mature (guide))
    12. Columba livia (rock pigeon) cli-miR-92-3p
    13. Cricetulus griseus (Chinese hamster) cgr-miR-92a-3p
    14. Cyprinus carpio ccr-miR-92a
    15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-92a-3p
    16. Daubentonia madagascariensis dma-miR-92a
    17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-92-P1c_3p (mature (guide))
    18. Equus caballus eca-miR-92a
    19. Gadus morhua (Atlantic cod) Gmo-Mir-92-P1a1_3p (mature (guide))
    20. Gallus gallus Gga-Mir-92-P1c_3p (mature (guide))
    21. Gekko japonicus Gja-Mir-92-P1c_3p (mature (guide))
    22. Gorilla gorilla ggo-miR-92
    23. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-92a
    24. Homo sapiens (human) hsa-miR-92a-3p
    25. Ictalurus punctatus (channel catfish) ipu-miR-92a
    26. Lagothrix lagotricha (brown woolly monkey) lla-miR-92
    27. Latimeria chalumnae Lch-Mir-92-P1a_3p (mature (guide))
    28. Lemur catta lca-miR-92
    29. Lepisosteus oculatus Loc-Mir-92-P1a_3p (mature (guide))
    30. Macaca mulatta mml-miR-92a-3p
    31. Macaca nemestrina (pig-tailed macaque) mne-miR-92
    32. Maylandia zebra mze-miR-92a
    33. Microcaecilia unicolor Mun-Mir-92-P1a_3p (mature (guide))
    34. Microcebus murinus mmr-miR-92b
    35. Monodelphis domestica mdo-miR-92a-3p
    36. Monopterus albus (swamp eel) Mal-Mir-92-P1a1_3p (mature (guide))
    37. Mus musculus Mmu-Mir-92-P1a_3p (mature (guide))
    38. Neolamprologus brichardi nbr-miR-92a
    39. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-92a
    40. Ophiophagus hannah oha-miR-92a-3p
    41. Oreochromis niloticus oni-miR-92a
    42. Ornithorhynchus anatinus (platypus) oan-miR-92a-3p
    43. Oryctolagus cuniculus ocu-miR-92a-3p
    44. Otolemur garnettii (small-eared galago) oga-miR-92a
    45. Pan paniscus (pygmy chimpanzee) ppa-miR-92a
    46. Pan troglodytes (chimpanzee) ptr-miR-92
    47. Papio hamadryas pha-miR-92a
    48. Penaeus japonicus miR-92a
    49. Petromyzon marinus Pma-Mir-92-P1h_3p (mature (guide))
    50. Pongo pygmaeus (Bornean orangutan) ppy-miR-92
    51. Pteropus alecto (black flying fox) pal-miR-92a-3p
    52. Pundamilia nyererei pny-miR-92
    53. Python bivittatus (Burmese python) pbv-miR-92a-3p
    54. Rattus norvegicus Rno-Mir-92-P1a_3p (mature (guide))
    55. Saguinus labiatus (red-chested mustached tamarin) sla-miR-92
    56. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-92a
    57. Salmo salar (Atlantic salmon) ssa-miR-92a-3p
    58. Sarcophilus harrisii Sha-Mir-92-P1c_3p (mature (guide))
    59. Scyliorhinus torazame (cloudy catshark) Sto-Mir-92-P1c_3p (mature (guide))
    60. Sphenodon punctatus (tuatara) Spt-Mir-92-P1c_3p (mature (guide))
    61. Sus scrofa (pig) ssc-miR-92a
    62. Taeniopygia guttata (zebra finch) tgu-miR-92-3p
    63. Takifugu rubripes (torafugu) fru-miR-92
    64. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-92
    65. Tor tambroides miR-92a-3p
    66. Tupaia chinensis tch-miR-92a-3p
    67. Xenopus laevis (African clawed frog) xla-miR-92a-3p
    68. Xenopus tropicalis Xtr-Mir-92-P1c_3p (mature (guide))
    Publications New