Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS0000376896_559292

Automated summary: This snoRNA sequence is 88 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (ENA, RefSeq, IntAct, SGD). Described in 29 papers. Matches 1 Rfam family (snR56, RF01188). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR56 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 1

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11793478 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUAACAUGAUGAAAAAAUAUAUUAACACAGACCUGUACUGAACUUUUCGAAGUUUUGCAGAUAACAAUAUUGCUUUUUUUCUCUGACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 94 other species

    1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR56
    2. Saccharomyces cerevisiae EC1118 SNR56
    3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR56
    4. Saccharomyces cerevisiae PE-2 SNR56
    5. Saccharomyces cerevisiae R008 snR56
    6. Saccharomyces cerevisiae synthetic construct C/D box small nucleolar RNA (snoRNA)
    7. Saccharomyces cerevisiae YJM1078 SNR56
    8. Saccharomyces cerevisiae YJM1083 SNR56
    9. Saccharomyces cerevisiae YJM1129 SNR56
    10. Saccharomyces cerevisiae YJM1133 SNR56
    11. Saccharomyces cerevisiae YJM1190 SNR56
    12. Saccharomyces cerevisiae YJM1199 SNR56
    13. Saccharomyces cerevisiae YJM1208 SNR56
    14. Saccharomyces cerevisiae YJM1242 SNR56
    15. Saccharomyces cerevisiae YJM1244 SNR56
    16. Saccharomyces cerevisiae YJM1248 SNR56
    17. Saccharomyces cerevisiae YJM1250 SNR56
    18. Saccharomyces cerevisiae YJM1252 SNR56
    19. Saccharomyces cerevisiae YJM1273 SNR56
    20. Saccharomyces cerevisiae YJM1307 SNR56
    21. Saccharomyces cerevisiae YJM1311 SNR56
    22. Saccharomyces cerevisiae YJM1326 SNR56
    23. Saccharomyces cerevisiae YJM1332 SNR56
    24. Saccharomyces cerevisiae YJM1336 SNR56
    25. Saccharomyces cerevisiae YJM1338 SNR56
    26. Saccharomyces cerevisiae YJM1341 SNR56
    27. Saccharomyces cerevisiae YJM1342 SNR56
    28. Saccharomyces cerevisiae YJM1355 SNR56
    29. Saccharomyces cerevisiae YJM1356 SNR56
    30. Saccharomyces cerevisiae YJM1381 SNR56
    31. Saccharomyces cerevisiae YJM1383 SNR56
    32. Saccharomyces cerevisiae YJM1385 SNR56
    33. Saccharomyces cerevisiae YJM1386 SNR56
    34. Saccharomyces cerevisiae YJM1387 SNR56
    35. Saccharomyces cerevisiae YJM1388 SNR56
    36. Saccharomyces cerevisiae YJM1389 SNR56
    37. Saccharomyces cerevisiae YJM1399 SNR56
    38. Saccharomyces cerevisiae YJM1400 SNR56
    39. Saccharomyces cerevisiae YJM1401 SNR56
    40. Saccharomyces cerevisiae YJM1402 SNR56
    41. Saccharomyces cerevisiae YJM1415 SNR56
    42. Saccharomyces cerevisiae YJM1417 SNR56
    43. Saccharomyces cerevisiae YJM1418 SNR56
    44. Saccharomyces cerevisiae YJM1419 SNR56
    45. Saccharomyces cerevisiae YJM1433 SNR56
    46. Saccharomyces cerevisiae YJM1434 SNR56
    47. Saccharomyces cerevisiae YJM1439 SNR56
    48. Saccharomyces cerevisiae YJM1443 SNR56
    49. Saccharomyces cerevisiae YJM1444 SNR56
    50. Saccharomyces cerevisiae YJM1447 SNR56
    51. Saccharomyces cerevisiae YJM1450 SNR56
    52. Saccharomyces cerevisiae YJM1460 SNR56
    53. Saccharomyces cerevisiae YJM1463 SNR56
    54. Saccharomyces cerevisiae YJM1477 SNR56
    55. Saccharomyces cerevisiae YJM1478 SNR56
    56. Saccharomyces cerevisiae YJM1479 SNR56
    57. Saccharomyces cerevisiae YJM1526 SNR56
    58. Saccharomyces cerevisiae YJM1527 SNR56
    59. Saccharomyces cerevisiae YJM1573 SNR56
    60. Saccharomyces cerevisiae YJM1574 SNR56
    61. Saccharomyces cerevisiae YJM1592 SNR56
    62. Saccharomyces cerevisiae YJM1615 SNR56
    63. Saccharomyces cerevisiae YJM189 SNR56
    64. Saccharomyces cerevisiae YJM193 SNR56
    65. Saccharomyces cerevisiae YJM195 SNR56
    66. Saccharomyces cerevisiae YJM244 SNR56
    67. Saccharomyces cerevisiae YJM248 SNR56
    68. Saccharomyces cerevisiae YJM270 SNR56
    69. Saccharomyces cerevisiae YJM271 SNR56
    70. Saccharomyces cerevisiae YJM320 SNR56
    71. Saccharomyces cerevisiae YJM326 SNR56
    72. Saccharomyces cerevisiae YJM428 SNR56
    73. Saccharomyces cerevisiae YJM450 SNR56
    74. Saccharomyces cerevisiae YJM451 SNR56
    75. Saccharomyces cerevisiae YJM453 SNR56
    76. Saccharomyces cerevisiae YJM456 SNR56
    77. Saccharomyces cerevisiae YJM470 SNR56
    78. Saccharomyces cerevisiae YJM541 SNR56
    79. Saccharomyces cerevisiae YJM554 SNR56
    80. Saccharomyces cerevisiae YJM627 SNR56
    81. Saccharomyces cerevisiae YJM681 SNR56
    82. Saccharomyces cerevisiae YJM682 SNR56
    83. Saccharomyces cerevisiae YJM683 SNR56
    84. Saccharomyces cerevisiae YJM693 SNR56
    85. Saccharomyces cerevisiae YJM969 SNR56
    86. Saccharomyces cerevisiae YJM972 SNR56
    87. Saccharomyces cerevisiae YJM975 SNR56
    88. Saccharomyces cerevisiae YJM978 SNR56
    89. Saccharomyces cerevisiae YJM981 SNR56
    90. Saccharomyces cerevisiae YJM984 SNR56
    91. Saccharomyces cerevisiae YJM987 SNR56
    92. Saccharomyces cerevisiae YJM990 SNR56
    93. Saccharomyces cerevisiae YJM993 SNR56
    94. Saccharomyces cerevisiae YJM996 SNR56