Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-221-P2a_5p (mature (co-guide)) URS00003713CD_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUGGCAUACAAUGUAGAUUUCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-221-5p
  2. Cricetulus griseus cgr-miR-221-5p
  3. Danio rerio dre-miR-221-5p
  4. Dasypus novemcinctus dno-miR-221-5p
  5. Gallus gallus Gallus_gallus piRNA piR-gga-1004
  6. Macaca mulatta (Rhesus monkey) mml-miR-221-5p
  7. Mus musculus (house mouse) mmu-miR-221-5p
  8. Oryctolagus cuniculus (rabbit) ocu-miR-221-5p
  9. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-219324
  10. Sus scrofa ssc-miR-221-5p
  11. Taeniopygia guttata (zebra finch) tgu-miR-221-5p
  12. Tor tambroides miR-221-5p
Publications