Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-221-5p URS00003713CD_9544

Automated summary: This miRNA sequence is 26 nucleotides long and is found in Macaca mulatta. Annotated by 4 databases (MirGeneDB, miRBase, RefSeq, ENA). Described in 7 papers. Macaca mulatta (Rhesus monkey) mml-miR-221-5p sequence is a product of mml-miR-221, mml-miR-221-5p, MIR221, miR-221-5p, miR-221 genes. Found in the rhesus monkey reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCUGGCAUACAAUGUAGAUUUCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Bos taurus Bta-Mir-221-P1_5p* (star (passenger))
    2. Canis lupus familiaris (dog) Cfa-Mir-221-P1_5p* (star (passenger))
    3. Cavia porcellus cpo-miR-221-5p
    4. Cricetulus griseus (Chinese hamster) cgr-miR-221-5p
    5. Danio rerio dre-miR-221-5p
    6. Dasypus novemcinctus dno-miR-221-5p
    7. Gallus gallus Gga-Mir-221-P1_5p* (star (passenger))
    8. Homo sapiens Hsa-Mir-221-P1_5p* (star (passenger))
    9. Mus musculus mmu-miR-221-5p
    10. Oryctolagus cuniculus (rabbit) ocu-miR-221-5p
    11. Rattus norvegicus (Norway rat) Rno-Mir-221-P1_5p* (star (passenger))
    12. Sus scrofa (pig) ssc-miR-221-5p
    13. Taeniopygia guttata tgu-miR-221-5p
    14. Tor tambroides miR-221-5p