Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM978 SNR35 secondary structure diagram

Saccharomyces cerevisiae YJM978 SNR35 URS00003712F2_1294326

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUACAAAAUUAAUCGUGCGGAUUAAUAAUCCAGGACUAUAAAACCGUGUUGUUUAUAUCGAGUCUCUUUUGGUAUAAGCGUCAAGUCCAUCGGAGAGAUCAUCAUUUUGUUCAUCUUAAUGCCCUUUUGUGUAGGAAAUUGAGGGAAGUUUAGGCUUCUCAACAUUUUAAGACGCCUAUGCAAGGGCUGGUAGGACAGACAUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Saccharomyces cerevisiae Small nucleolar RNA snR35
  2. Saccharomyces cerevisiae PE-2 SNR35
  3. Saccharomyces cerevisiae S288C Small Nucleolar RNA
  4. Saccharomyces cerevisiae YJM1083 SNR35
  5. Saccharomyces cerevisiae YJM1549 SNR35
  6. Saccharomyces cerevisiae YJM969 SNR35
  7. Saccharomyces cerevisiae YJM972 SNR35
  8. Saccharomyces cerevisiae YJM975 SNR35
  9. Saccharomyces cerevisiae YJM981 SNR35
  10. Saccharomyces cerevisiae YJM984 SNR35
  11. Saccharomyces cerevisiae YJM987 SNR35
  12. Saccharomyces cerevisiae YJM990 SNR35
  13. Saccharomyces cerevisiae YJM993 SNR35
  14. Saccharomyces cerevisiae YJM996 SNR35
2D structure