Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00003712F2_559292

Automated summary: This snoRNA sequence is 204 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (RefSeq, Rfam, ENA, IntAct, SGD). Described in 37 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR35, RF01255). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR35 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 4

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

IntAct ID Participant Synonyms
EBI-10961083 URS0000077671_559292 EBI-10916376 URS0000077671_559292 snr190 yeast
EBI-10961087 URS0000176EA1_559292 EBI-10921924 URS0000176EA1_559292 snr41 yeast
EBI-10961074 URS0000459091_559292 EBI-10949023 URS0000459091_559292 snr68 yeast-1
EBI-10959475 O13516 D6W3T6 EBI-16176 O13516 RP21 RPS13A RPS9A S13 Small ribosomal subunit protein uS4-A YP28 YPL081W YS11 YS11A rs9a_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUACAAAAUUAAUCGUGCGGAUUAAUAAUCCAGGACUAUAAAACCGUGUUGUUUAUAUCGAGUCUCUUUUGGUAUAAGCGUCAAGUCCAUCGGAGAGAUCAUCAUUUUGUUCAUCUUAAUGCCCUUUUGUGUAGGAAAUUGAGGGAAGUUUAGGCUUCUCAACAUUUUAAGACGCCUAUGCAAGGGCUGGUAGGACAGACAUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR35
    2. Saccharomyces cerevisiae PE-2 SNR35
    3. Saccharomyces cerevisiae YJM1083 SNR35
    4. Saccharomyces cerevisiae YJM1549 SNR35
    5. Saccharomyces cerevisiae YJM969 SNR35
    6. Saccharomyces cerevisiae YJM972 SNR35
    7. Saccharomyces cerevisiae YJM975 SNR35
    8. Saccharomyces cerevisiae YJM978 SNR35
    9. Saccharomyces cerevisiae YJM981 SNR35
    10. Saccharomyces cerevisiae YJM984 SNR35
    11. Saccharomyces cerevisiae YJM987 SNR35
    12. Saccharomyces cerevisiae YJM990 SNR35
    13. Saccharomyces cerevisiae YJM993 SNR35
    14. Saccharomyces cerevisiae YJM996 SNR35
    2D structure New