Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-665 URS000036883B_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-665: Rno-mir-665 is a microRNA that has been studied in various contexts. In HSC-T6 cells, overexpression of lnc-BIHAA1 led to a significant decrease in the expression of rno-mir-665, along with rno-miR-667-5p and rno-miR-742-3p, suggesting a ceRNA regulation mode [PMC9331515]. In mice exposed to sevoflurane, the expression of miR-101b-3p was down-regulated, indicating its potential as a molecular target for preventing sevoflurane-induced cognitive impairment [PMC9331515]. On the other hand, propofol was found to up-regulate the expression of rno-mir-665 and induce neurotoxicity through negative regulation of BCL2L1 and increased caspase-3 expression [PMC9331515]. Rno-mir-665 is also involved in ceRNA networks associated with DEGs in the PI3K-AKT signaling pathway and is down-regulated in this context [PMC8636738]. Additionally, rno-mir-665 is highly expressed in an aluminum-exposed group and its related genes, circRNAs, and lncRNAs are lowly expressed [PMC8636738]. Rno-miR-101b-3p is decreased while rno-mir-665 is increased after aluminum treatment, indicating their importance as core molecules in ceRNA networks associated with DEGs [PMC8636738]. Furthermore, rno-mir-665 has direct targets in the VEGF signaling pathway [PMC5270432]. Overall, these studies highlight the involvement of rno-mir-665 in various biological processes and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAGGAGGCUGAGGUCCCUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications