Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-193a-5p URS0000367985_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-193a: Bta-mir-193a is a differentially expressed (DE) microRNA (miRNA) in bovine mammary epithelial cells stimulated with S. uberis in vitro [PMC4065264]. It is generated from bta-mir-193a-2 and is reversely complementary to bta-mir-193a-3p [PMC4029070]. Bta-mir-193a, along with other miRNAs such as bta-miR-200c, bta-miR-210, and let-7e, has been identified as DE in response to S. uberis and LPS in other species [PMC3589390]. It has been found to be down-regulated at 4 hours post-infection (hpi) [PMC3589390]. Bta-mir-193a has been identified as a drug target for bovine disease and a potential regulatory marker for bovine trypanosomosis diagnosis and treatment [PMC6722470]. It is highly conserved across different species ranging from human to zebra [PMC6722470]. Bta-mir-193a has been shown to regulate the expression of proinflammatory cytokines, promote apoptosis, inhibit bacteria, and be involved in Toll-like receptor signaling during trypanosomosis infection [PMC6722470]. It is also significantly involved in gene silencing and RNA-induced silencing complex processes [PMC6722470]. In the context of host-virus interaction, bta-miR-29b and bta-mir-193a have been found to be down-regulated upon CPIV3 infection and likely participate in MDBK cells' response to the virus [PMC5885596]. However, the expression levels of bta-miR-2333 and other miRNAs close to bta-mir-193a were not significantly overexpressed in cultured myoblast cells transfected with the expression vector OPmiR-365-3p [PMC7802253].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGUCUUUGCGGGCGAGAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Anolis carolinensis Aca-Mir-193-P1b_5p (mature (guide))
  2. Canis lupus familiaris cfa-miR-193a
  3. Cavia porcellus (domestic guinea pig) cpo-miR-193a-5p
  4. Cervus elaphus (red deer) cel-miR-193a-5p
  5. Chrysemys picta bellii Cpi-Mir-193-P1b_5p (mature (guide))
  6. Dasypus novemcinctus dno-miR-193a-5p
  7. Equus caballus (horse) eca-miR-193a-5p
  8. Gallus gallus (chicken) gga-miR-193a-5p
  9. Homo sapiens hsa-miR-193a-5p
  10. Macaca mulatta mml-miR-193a-5p
  11. Ophiophagus hannah (king cobra) oha-miR-193-5p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-193a-5p
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-193a-5p
  14. Pteropus alecto (black flying fox) pal-miR-193a-5p
  15. Python bivittatus pbv-miR-193a-5p
  16. Sarcophilus harrisii Sha-Mir-193-P1b_5p (mature (guide))
  17. Sphenodon punctatus Spt-Mir-193-P1b_5p (mature (guide))
  18. Sus scrofa (pig) ssc-miR-193a-5p
  19. Taeniopygia guttata (zebra finch) tgu-miR-193b-5p
Publications