Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-193a-5p URS0000367985_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGUCUUUGCGGGCGAGAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Anolis carolinensis Aca-Mir-193-P1b_5p (mature (guide))
  2. Bos taurus (cattle) bta-miR-193a-5p
  3. Canis lupus familiaris cfa-miR-193a
  4. Cavia porcellus (domestic guinea pig) cpo-miR-193a-5p
  5. Cervus elaphus (red deer) cel-miR-193a-5p
  6. Chrysemys picta bellii Cpi-Mir-193-P1b_5p (mature (guide))
  7. Dasypus novemcinctus dno-miR-193a-5p
  8. Equus caballus (horse) eca-miR-193a-5p
  9. Gallus gallus (chicken) gga-miR-193a-5p
  10. Homo sapiens hsa-miR-193a-5p
  11. Macaca mulatta mml-miR-193a-5p
  12. Ophiophagus hannah (king cobra) oha-miR-193-5p
  13. Oryctolagus cuniculus (rabbit) ocu-miR-193a-5p
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-193a-5p
  15. Pteropus alecto (black flying fox) pal-miR-193a-5p
  16. Python bivittatus pbv-miR-193a-5p
  17. Sarcophilus harrisii Sha-Mir-193-P1b_5p (mature (guide))
  18. Sphenodon punctatus Spt-Mir-193-P1b_5p (mature (guide))
  19. Taeniopygia guttata (zebra finch) tgu-miR-193b-5p
Publications