Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-518b URS00003676C9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-518b: Hsa-mir-518b is a microRNA that has been identified as an independent prognostic factor for bladder urothelial carcinoma [PMC5588142]. It has been found that hsa-mir-518b levels are low in placenta during FGR pregnancies, but these changes are not reflected in maternal plasma [PMC7708817]. In a study comparing different samples, hsa-mir-518b was found to be differentially expressed in bladder urothelial carcinoma [PMC8686203]. The expression of hsa-mir-518b was upregulated in both data sets of bladder urothelial carcinoma, but the expression of hsa-miR-486-5p was upregulated in one data set and significantly downregulated in another [PMC10116350]. Hsa-miR-518e and hsa-mir-518b, which are homologues of hsa-miR-518f, were found to be upregulated in hepatocellular carcinoma (HCC) [PMC5937522]. In a study investigating the expression of miRNAs, it was observed that hsa-mir-518b was upregulated more than twofold [PMC10083302]. Additionally, seven miRNAs were identified to overlap with hsa-mir-518b [PMC8566004]. References: [PMC5588142] [PMC7708817] [PMC8686203] [PMC10116350] [PMC5937522] [PMC10083302] [PMC8566004]

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGCGCUCCCCUUUAGAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla ggo-miR-518b (MIR518B)
  2. Gorilla gorilla (western gorilla) ggo-miR-518b
  3. Pan troglodytes (chimpanzee) ptr-miR-518b
Publications