Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-981-3p URS00003674BD_7227

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila melanogaster. Annotated by 5 databases (FlyBase, miRBase, MirGeneDB, RefSeq, ENA). Drosophila melanogaster (fruit fly) dme-miR-981-3p sequence is a product of miR-981, mir-981-RA, 981-R, FBgn0262178, dme-miR-981, mir-981, miR-981-3p, 981-RA, dme-miR-981-3p genes. Found in the fruit fly reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUCGUUGUCGACGAAACCUGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-981
    2. Bactrocera dorsalis (oriental fruit fly) bdo-miR-981
    3. Blattella germanica Bge-Mir-76_3p (mature (guide))
    4. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-981
    5. Cochliomyia macellaria mature cma-miR-981
    6. Culex quinquefasciatus (southern house mosquito) cqu-miR-981
    7. Daphnia magna Dma-Mir-76_3p (mature (guide))
    8. Daphnia pulex (common water flea) dpu-miR-981
    9. Dinoponera quadriceps dqu-miR-981-3p
    10. Drosophila ananassae Dan-Mir-76_3p (mature (guide))
    11. Drosophila mojavensis Dmo-Mir-76_3p (mature (guide))
    12. Drosophila pseudoobscura dps-miR-981-3p
    13. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330793_df_nrg
    14. Drosophila simulans Dsi-Mir-76_3p (mature (guide))
    15. Drosophila virilis dvi-miR-981-3p
    16. Drosophila yakuba Dya-Mir-76_3p (mature (guide))
    17. Heliconius melpomene hme-miR-981
    18. Manduca sexta (tobacco hornworm) mse-miR-981
    19. Polistes canadensis pca-miR-981-3p
    20. Tribolium castaneum (red flour beetle) tca-miR-981
    Publications New