Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 76 (SNORD76) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 76 (SNORD76) URS0000361A8E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD76: SNORD76 is a C/D box snoRNA that has been found to be significantly upregulated in non-small cell lung cancer (NSCLC) [PMC9826665]. In hepatocellular carcinoma (HCC) cell lines, knockdown of SNORD76 resulted in cell cycle arrest at the G0/G1 phase and increased apoptosis, while overexpression of SNORD76 induced cell proliferation [PMC5838311]. The upregulated expression of SNORD76 led to a decrease in the expression of p107, cyclin A1, and cyclin B1 genes, and an increase in the expression of the Rb gene [PMC5838311]. In glioma cells, high expression of snoRNA SNHG18 may result in radiotherapy resistance by inhibiting Semaphorin 5A [PMC8762369]. However, there is currently no evidence regarding the expression pattern of SNHG18 in glioma tissue [PMC8762369].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCACAAUGAUGACAGUUUAUUUGCUACUCUUGAGUGCUAGAAUGAUGAGGAUCUUAACCACCAUUAUCUUAACUGAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications