Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR530-3p URS000035D5FB_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR530-3p: Osa-mir530-3p is a miRNA derived from the 3' arm of pre-MIR530. It has been found to be up-regulated in the phyB mutant compared to the wild type [PMC4448008]. However, it is unclear whether osa-mir530-3p is a functional miRNA in the phyB-mediated signaling pathway [PMC4448008]. In a study comparing different rice genotypes, osa-mir530-3p was found to be downregulated in tolerant genotypes except for one sample, while it was upregulated in sensitive genotypes [PMC9614602]. The expression of osa-mir530-3p was also found to be downregulated in tolerant rice genotypes except for 1-day low-light-treated samples, while it was upregulated in sensitive genotypes [PMC9614602]. The predicted target gene of osa-mir530-3p is ubiquinone biosynthesis protein COQ4 [PMC9614602]. Furthermore, expression analysis and validation through qRT-PCR showed that osa-mir530-3p and other known and novel miRNAs are involved in low-light-mediated signaling mechanisms [PMC9614602]. Osa-mir530-3p has also been found to target Os05g34720, a transcription factor in rice [PMC3287166]. In addition, there are several other flowering-related and early-flowering-related miRNAs identified in rice [PMC3875430]. Overall, osa-mir530-3p has been shown to have differential expression patterns and potential target genes involved in various signaling pathways.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUGCAGAGGCAGAUGCAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Ananas comosus (pineapple) microRNA 530d
  2. Oryza sativa Japonica Group microRNA osa-miR530-3p
Publications