Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata aly-miR394b-5p URS0000359C77_59689

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Arabidopsis lyrata. Annotated by 2 databases (ENA, miRBase). Described in 1 paper. Arabidopsis lyrata aly-miR394b-5p sequence is a product of miR394b-5p, miR394a-5p, aly-miR394a, miR394a, aly-miR394b-5p, miR394b, aly-miR394b, miR394, aly-miR394a-5p genes. Found in the Arabidopsis lyrata reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUGGCAUUCUGUCCACCUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 48 other species

    1. Aegilops tauschii ata-miR394-5p
    2. Amborella trichopoda atr-miR394
    3. Ananas comosus (pineapple) microRNA 394c
    4. Arabidopsis thaliana (thale cress) ath-miR394b-5p
    5. Arachis hypogaea (peanut) ahy-miR394
    6. Asparagus officinalis aof-miR394
    7. Brachypodium distachyon (stiff brome) bdi-miR394
    8. Brassica napus (rape) bna-miR394a
    9. Carica papaya (papaya) cpa-miR394b
    10. Citrus sinensis csi-miR394b-5p
    11. Corchorus capsularis (jute) sRNA CCACVL1_02652
    12. Corchorus olitorius ahy-miR3
    13. Cucumis melo (muskmelon) cme-miR394b
    14. Cynara cardunculus cca-miR394
    15. Fragaria vesca subsp. vesca fve-miR394
    16. Glycine max gma-miR394d
    17. Gossypium hirsutum (cotton) ghr-miR394a
    18. Linum usitatissimum lus-miR394b
    19. Malus domestica mdm-miR394b
    20. Manihot esculenta (cassava) mes-miR394a
    21. Nicotiana tabacum (common tobacco) nta-miR394
    22. Oryza sativa Japonica Group microRNA osa-miR394
    23. Oryza sativa osa-miR394
    24. Pachycladon cheesemanii Pch-miR394a
    25. Pachycladon fastigiatum Pfa-miR394a
    26. Picea abies pab-miR394c
    27. Populus tomentosa Pto-miR394b-5p
    28. Populus trichocarpa (black cottonwood) ptc-miR394b-5p
    29. Prunus persica (peach) ppe-miR394a
    30. Rosa chinensis ath-miR394a
    31. Salvia sclarea (clary) ssl-miR394
    32. Solanum lycopersicum (tomato) sly-miR394-5p
    33. Solanum tuberosum (potato) stu-miR384-5p
    34. Sorghum bicolor sbi-miR394b
    35. Theobroma cacao (cacao) tcc-miR394a
    36. Vitis vinifera (wine grape) vvi-miR394b
    37. Zea mays zma-miR394b-5p