Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR394 URS0000359C77_39947

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Described in 1 paper. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR394 sequence is a product of miR394, osa-miR394 genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUGGCAUUCUGUCCACCUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Aegilops tauschii ata-miR394-5p
    2. Amborella trichopoda atr-miR394
    3. Ananas comosus (pineapple) microRNA 394c
    4. Arabidopsis lyrata aly-miR394b-5p
    5. Arabidopsis thaliana ath-miR394a
    6. Arachis hypogaea ahy-miR394
    7. Asparagus officinalis aof-miR394
    8. Brachypodium distachyon bdi-miR394
    9. Brassica napus (rape) bna-miR394a
    10. Carica papaya (papaya) cpa-miR394a
    11. Citrus sinensis csi-miR394b-5p
    12. Corchorus capsularis sRNA CCACVL1_02652
    13. Corchorus olitorius ahy-miR3
    14. Cucumis melo (muskmelon) cme-miR394a
    15. Cynara cardunculus cca-miR394
    16. Fragaria vesca subsp. vesca fve-miR394
    17. Glycine max gma-miR394d
    18. Gossypium hirsutum (cotton) ghr-miR394a
    19. Linum usitatissimum (flax) lus-miR394a
    20. Malus domestica mdm-miR394b
    21. Manihot esculenta mes-miR394b
    22. Nicotiana tabacum (common tobacco) nta-miR394
    23. Oryza sativa osa-miR394
    24. Pachycladon cheesemanii Pch-miR394a
    25. Pachycladon fastigiatum Pfa-miR394a
    26. Picea abies (Norway spruce) pab-miR394c
    27. Populus tomentosa Pto-miR394b-5p
    28. Populus trichocarpa (black cottonwood) ptc-miR394b-5p
    29. Prunus persica (peach) ppe-miR394b
    30. Rosa chinensis ath-miR394a
    31. Salvia sclarea (clary) ssl-miR394
    32. Solanum lycopersicum sly-miR394-5p
    33. Solanum tuberosum (potato) stu-miR384-5p
    34. Sorghum bicolor (sorghum) sbi-miR394b
    35. Theobroma cacao (cacao) tcc-miR394b
    36. Vitis vinifera vvi-miR394b
    37. Zea mays zma-miR394b-5p