Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3917 URS000035925E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3917: Hsa-mir-3917 is a microRNA that has been identified as a component of various diagnostic and prognostic signatures in different types of cancer, including stomach adenocarcinoma (STAD) and colon cancer (COAD) [PMC7772397] [PMC6856753] [PMC6120165] [PMC6937800]. In STAD, hsa-mir-3917 is part of a diagnostic signature that includes other microRNAs such as hsa-mir-509-2, hsa-mir-495, and hsa-mir-145, which may serve as independent biomarkers for overall survival [PMC6856753]. In COAD, the coefficient of hsa-mir-3917 is negative, indicating its protective effect against the disease [PMC6937800]. Additionally, hsa-mir-3917 has been found to be upregulated in chronic pancreatitis (CP) tissue compared to normal tissue [PMC7606899]. Furthermore, miRNAs such as hsa-miR-4697-3p have been reported to have potential roles in drug resistance and relapse in various types of cancer [PMC8777531]. Overall, the presence and expression levels of hsa-mir-3917 have been implicated in the diagnosis and prognosis of different types of cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCGGACUGAGCAGGUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications