Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4635 URS000035709C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4635: Hsa-mir-4635 is a microRNA (miRNA) that has been identified in studies related to cardiac diseases and obesity. It has been suggested that hsa-mir-4635, along with other miRNAs such as hsa-Mir-4710, hsa-Mir-3934, hsa-Mir-665, and has-Mir-4695-5p, may play a role in regulating cardiac marker genes during hypertrophy and other cardiac diseases [PMC3842578]. These miRNAs have been found to be associated with ANP, BNP, TNNT2, TNNI3, α-Actinin, and MYH-7 [PMC3842578]. In a study on non-small cell lung cancer (NSCLC) patients, hsa-mir-4635 was found to have a significant correlation with overall survival (OS) along with other miRNAs such as hsa-miR-146b and hsa-miR-27b [PMC8281680]. The expression values of these miRNAs were used to calculate a TIM-Sig score for predicting OS in NSCLC patients [PMC8281680]. Hsa-mir-4635 was also used as one of the primers in a study on obesity-related gene regulation [PMC6527545]. It was found that downregulated expression of hsa-mir-4635 was associated with upregulated genes in patients with obesity [PMC6102639]. These findings suggest that hsa-mir-4635 may have important regulatory functions in various disease contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUGAAGUCAGAACCCGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications