Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-375 URS000035563D_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (miRBase, MirGeneDB, ENA, RefSeq). Gallus gallus (chicken) gga-miR-375 sequence is a product of MIR375, miR-375, gga-miR-375 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUUGUUCGUUCGGCUCGCGUUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Alligator mississippiensis Ami-Mir-375_3p (mature (guide))
    2. Anolis carolinensis (green anole) aca-miR-375-3p
    3. Chrysemys picta bellii Cpi-Mir-375_3p (mature (guide))
    4. Chrysemys picta cpi-miR-375-3p
    5. Columba livia (rock pigeon) cli-miR-375-3p
    6. Cyprinus carpio ccr-miR-375
    7. Danio rerio dre-miR-375
    8. Eisenia fetida (common brandling worm) Efe-Mir-375_3p (mature (guide))
    9. Euprymna scolopes Esc-Mir-375_3p (mature (guide))
    10. Gadus morhua (Atlantic cod) gmo-miR-375-3p
    11. Gekko japonicus Gja-Mir-375_3p (mature (guide))
    12. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-375
    13. Latimeria chalumnae Lch-Mir-375_3p (mature (guide))
    14. Lepisosteus oculatus Loc-Mir-375_3p (mature (guide))
    15. Lingula anatina Lan-Mir-375_3p (mature (guide))
    16. Lottia gigantea lgi-miR-375
    17. Maylandia zebra mze-miR-375
    18. Melibe leonina mle-miR-375-3p
    19. Microcaecilia unicolor Mun-Mir-375-P7b_3p (mature (guide))
    20. Monopterus albus (swamp eel) Mal-Mir-375-P2_3p (mature (guide))
    21. Mus musculus Mus_musculus piRNA piR-mmu-50877049
    22. Nautilus pompilius Npo-Mir-375_3p (mature (guide))
    23. Neolamprologus brichardi nbr-miR-375
    24. Octopus bimaculoides Obi-Mir-375_3p (mature (guide))
    25. Octopus vulgaris Ovu-Mir-375_3p (mature (guide))
    26. Ophiophagus hannah oha-miR-375-3p
    27. Oreochromis niloticus oni-miR-375
    28. Petromyzon marinus pma-miR-375a-3p
    29. Pundamilia nyererei pny-miR-375
    30. Python bivittatus (Burmese python) pbv-miR-375-3p
    31. Salmo salar (Atlantic salmon) ssa-miR-375-3p
    32. Scyliorhinus torazame (cloudy catshark) Sto-Mir-375_3p (mature (guide))
    33. Sphenodon punctatus (tuatara) Spt-Mir-375_3p (mature (guide))
    34. Taeniopygia guttata (zebra finch) tgu-miR-375
    35. Takifugu rubripes (torafugu) fru-miR-375
    36. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-375
    37. Tor tambroides miR-375
    38. Xenopus laevis (African clawed frog) Xla-Mir-375-P14_3p (mature (guide))
    39. Xenopus tropicalis xtr-miR-375
    Publications New