Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-375 URS000035563D_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (RefSeq, MirGeneDB, ENA, miRBase). Described in 10 papers. Danio rerio (zebrafish) dre-miR-375 sequence is a product of mir375-2, miR-375, mir375-1, dre-miR-375 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUGUUCGUUCGGCUCGCGUUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 46 other species

    1. Alligator mississippiensis Ami-Mir-375_3p (mature (guide))
    2. Anolis carolinensis (green anole) aca-miR-375-3p
    3. Chrysemys picta bellii (western painted turtle) Cpi-Mir-375_3p (mature (guide))
    4. Chrysemys picta cpi-miR-375-3p
    5. Columba livia (rock pigeon) cli-miR-375-3p
    6. Cyprinus carpio (common carp) ccr-miR-375
    7. Eisenia fetida (common brandling worm) Efe-Mir-375_3p (mature (guide))
    8. Gadus morhua (Atlantic cod) gmo-miR-375-3p
    9. Gallus gallus (chicken) gga-miR-375
    10. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-375
    11. Lingula anatina Lan-Mir-375_3p (mature (guide))
    12. Lottia gigantea (owl limpet) lgi-miR-375
    13. Maylandia zebra mze-miR-375
    14. Melibe leonina mle-miR-375-3p
    15. Mus musculus Mus_musculus piRNA piR-mmu-50877049
    16. Neolamprologus brichardi nbr-miR-375
    17. Ophiophagus hannah oha-miR-375-3p
    18. Oreochromis niloticus (Nile tilapia) oni-miR-375
    19. Petromyzon marinus pma-miR-375a-3p
    20. Pundamilia nyererei pny-miR-375
    21. Python bivittatus (Burmese python) pbv-miR-375-3p
    22. Salmo salar ssa-miR-375-3p
    23. Scyliorhinus torazame Sto-Mir-375_3p (mature (guide))
    24. Taeniopygia guttata (zebra finch) tgu-miR-375
    25. Takifugu rubripes (torafugu) fru-miR-375
    26. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-375
    27. Tor tambroides miR-375
    28. Xenopus laevis (African clawed frog) xla-miR-375
    29. Xenopus tropicalis xtr-miR-375