Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-293-5p URS000034CD58_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-293: Mmu-mir-293 is a specific TaqMan miRNA assay used in a study [PMC5599553]. It is part of a larger pri-miRNA transcript detected exclusively in CCE cells [PMC3213133]. The expression pattern of mmu-mir-293 varies in different libraries, with some libraries showing higher expression of mmu-miR-295, mmu-miR-294, or mmu-mir-293 [PMC3287988]. The unusual pattern of mmu-mir-293 expression was observed in IDT-libraries [PMC3287988]. The expression levels of mmu-mir-290, mmu-mir-291a, mmu-mir-291b, mmu-mir-292, mmu-mir-293, mmu-mir-294 and mmu-mir-295 were reduced in the study [PMC9149258]. A reverse transcriptase primer for normalization of miR-122 values was used for cDNA synthesis of plasma samples [PMC7356411]. Various forward primers were used for the detection and analysis of different miRNAs including the forward primer for detecting the expression levels of mmu-miR-293 [PMC3384982]. References: [PMC5599553] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5599553/ [PMC3213133] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3213133/ [PMC3287988] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3287988/ [PMC9149258] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9149258/ [PM7356411] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM7356411/ [PM3384982] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM3384982/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCAAACUGUGUGACAUUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications