Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-206-3p URS000034B6F5_9986

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Oryctolagus cuniculus. Annotated by 3 databases (MirGeneDB, RefSeq, miRBase). Oryctolagus cuniculus (rabbit) ocu-miR-206-3p sequence is a product of ocu-miR-206, miR-206, miR-206-3p, MIR206, ocu-miR-206-3p genes. Found in the rabbit reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGAAUGUAAGGAAGUGUGUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 51 other species

    1. Alligator mississippiensis (American alligator) ami-miR-206-3p
    2. Anolis carolinensis Aca-Mir-1-P2_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-206
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-206
    5. Canis lupus familiaris (dog) cfa-miR-206
    6. Cavia porcellus cpo-miR-206-3p
    7. Chrysemys picta bellii Cpi-Mir-1-P2_3p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-206-3p
    9. Columba livia cli-miR-206-3p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-206
    11. Cyprinus carpio (common carp) ccr-miR-206
    12. Danio rerio (zebrafish) dre-miR-206-3p
    13. Dasypus novemcinctus dno-miR-206-3p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1-P2_3p (mature (guide))
    15. Equus caballus eca-miR-206
    16. Gadus morhua gmo-miR-206-3p
    17. Gallus gallus (chicken) gga-miR-206
    18. Gekko japonicus Gja-Mir-1-P2f_3p (mature (guide))
    19. Gorilla gorilla (western gorilla) ggo-miR-206
    20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-206
    21. Homo sapiens hsa-miR-206
    22. Ictalurus punctatus (channel catfish) ipu-miR-206
    23. Latimeria chalumnae Lch-Mir-1-P2_3p (mature (guide))
    24. Lepisosteus oculatus Loc-Mir-1-P2_3p (mature (guide))
    25. Macaca mulatta mml-miR-206
    26. Macaca nemestrina mne-miR-206
    27. Maylandia zebra (zebra mbuna) mze-miR-206
    28. Microcaecilia unicolor Mun-Mir-1-P2_3p (mature (guide))
    29. Monodelphis domestica Mdo-Mir-1-P2_3p (mature (guide))
    30. Monopterus albus Mal-Mir-1-P2a_3p (mature (guide))
    31. Mus musculus (house mouse) mmu-miR-206-3p
    32. Neolamprologus brichardi nbr-miR-206
    33. Ophiophagus hannah oha-miR-206
    34. Oreochromis niloticus (Nile tilapia) oni-miR-206
    35. Ornithorhynchus anatinus oan-miR-206-3p
    36. Ovis aries (sheep) Pri-miR206
    37. Pan troglodytes ptr-miR-206
    38. Paralichthys olivaceus pol-miR-206-3p
    39. Pongo pygmaeus (Bornean orangutan) ppy-miR-206
    40. Pteropus alecto pal-miR-206-3p
    41. Pundamilia nyererei pny-miR-206
    42. Python bivittatus (Burmese python) pbv-miR-206-3p
    43. Rattus norvegicus (Norway rat) rno-miR-206-3p
    44. Salmo salar ssa-miR-206-3p
    45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-1-P2_3p (mature (guide))
    46. Sphenodon punctatus Spt-Mir-1-P2_3p (mature (guide))
    47. Taeniopygia guttata Tgu-Mir-1-P2_3p (mature (guide))
    48. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-1-P2a_3p (mature (guide))
    49. Tor tambroides miR-206-3p
    50. Xenopus laevis xla-miR-206-3p
    51. Xenopus tropicalis (tropical clawed frog) xtr-miR-206
    Publications New