v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-206 URS000034B6F5_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-206: Cfa-mir-206 is a highly expressed miRNA in skeletal muscle [PMC4989286]. It is one of the 5 TE miRNAs found in both the dog heart and skeletal muscle [PMC4989286]. Transient elevations of cfa-mir-206 in the serum were observed, but they were not correlated with any microscopic findings and may be due to injury during animal handling [PMC4989286]. Cfa-mir-206 was included in a panel of miRNAs evaluated for heart, muscle, brain, sciatic nerve, testis, pancreas, and liver tissues [PMC4989286]. It was also selected as one of the 22 miRNAs for qPCR validation as a biomarker candidate for muscle toxicity [PMC4989286]. Downregulation of cfa-mir-206 was observed at 36 dpi and was associated with an attenuated inflammatory response by targeting tcf7l2 [PMC9558963]. Tcf7l2 is a potential target gene of cfa-mir-206 and is involved in various cellular processes such as cell-cell signaling and regulation of response to stimulus [PMC9558963]. Cfa-mir-206 has also been implicated in canine atrial fibrillation, with increased expression observed during atrial fibrillation induced by right atrial tachypacing [PMC4490541] [PMC5533140].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAUGUAAGGAAGUGUGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis ami-miR-206-3p
  2. Anolis carolinensis Aca-Mir-1-P2_3p (mature (guide))
  3. Bos taurus bta-miR-206
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-206
  5. Cavia porcellus cpo-miR-206-3p
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P2_3p (mature (guide))
  7. Chrysemys picta (Painted turtle) cpi-miR-206-3p
  8. Columba livia (rock pigeon) cli-miR-206-3p
  9. Cricetulus griseus (Chinese hamster) cgr-miR-206
  10. Cyprinus carpio (common carp) ccr-miR-206
  11. Danio rerio dre-miR-206-3p
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-206-3p
  13. Echinops telfairi Ete-Mir-1-P2_3p (mature (guide))
  14. Equus caballus (horse) eca-miR-206
  15. Gadus morhua (Atlantic cod) gmo-miR-206-3p
  16. Gallus gallus (chicken) gga-miR-206
  17. Gekko japonicus Gja-Mir-1-P2f_3p (mature (guide))
  18. Gorilla gorilla gorilla ggo-miR-206 (MIR206)
  19. Gorilla gorilla ggo-miR-206
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-206
  21. Homo sapiens hsa-miR-206
  22. Ictalurus punctatus (channel catfish) ipu-miR-206
  23. Latimeria chalumnae Lch-Mir-1-P2_3p (mature (guide))
  24. Lepisosteus oculatus (spotted gar) Loc-Mir-1-P2_3p (mature (guide))
  25. Macaca mulatta mml-miR-206
  26. Macaca nemestrina mne-miR-206
  27. Maylandia zebra (zebra mbuna) mze-miR-206
  28. Microcaecilia unicolor Mun-Mir-1-P2_3p (mature (guide))
  29. Monodelphis domestica Mdo-Mir-1-P2_3p (mature (guide))
  30. Monopterus albus (swamp eel) Mal-Mir-1-P2a_3p (mature (guide))
  31. Mus musculus (house mouse) mmu-miR-206-3p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-206
  33. Ophiophagus hannah (king cobra) oha-miR-206
  34. Oreochromis niloticus oni-miR-206
  35. Ornithorhynchus anatinus (platypus) oan-miR-206-3p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-206-3p
  37. Ovis aries Pri-miR206
  38. Pan troglodytes ptr-miR-206
  39. Paralichthys olivaceus (Japanese flounder) pol-miR-206-3p
  40. Pongo pygmaeus ppy-miR-206
  41. Pteropus alecto (black flying fox) pal-miR-206-3p
  42. Pundamilia nyererei pny-miR-206
  43. Python bivittatus (Burmese python) pbv-miR-206-3p
  44. Rattus norvegicus rno-miR-206-3p
  45. Salmo salar (Atlantic salmon) ssa-miR-206-3p
  46. Sarcophilus harrisii Sha-Mir-1-P2_3p (mature (guide))
  47. Sphenodon punctatus Spt-Mir-1-P2_3p (mature (guide))
  48. Taeniopygia guttata Tgu-Mir-1-P2_3p (mature (guide))
  49. Tetraodon nigroviridis Tni-Mir-1-P2a_3p (mature (guide))
  50. Tor tambroides miR-206-3p
  51. Xenopus laevis (African clawed frog) xla-miR-206-3p
  52. Xenopus tropicalis xtr-miR-206
 Publications