Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-206 URS000034B6F5_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, miRBase, MirGeneDB, RefSeq, IntAct, GeneCards, ENA, TarBase). Described in 59 papers. Homo sapiens (human) hsa-miR-206 sequence is a product of MIR206, miR-206, hsa-miR-206 genes. Found in the human reference genome. Interacts with protein-coding genes, including AF6q21, ARHGEF18, BRCA1, BRCC1, CASP, CCND2, CDC47, CHEK1, CHK1, CIG.

Interactions 2

According to IntAct, Homo sapiens (human) hsa-miR-206 interacts with:

IntAct ID Participant Synonyms
EBI-20566842 intact:EBI-20562147 EBI-20562147 ENST00000397752.7 mrna_cmet
EBI-20566859 intact:EBI-20562147 EBI-20562147 ENST00000397752.7 mrna_cmet

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAAUGUAAGGAAGUGUGUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Alligator mississippiensis ami-miR-206-3p
    2. Anolis carolinensis Aca-Mir-1-P3_3p (mature (guide))
    3. Bos taurus bta-miR-206
    4. Callithrix jacchus cja-miR-206
    5. Canis lupus familiaris (dog) cfa-miR-206
    6. Cavia porcellus cpo-miR-206-3p
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P3_3p (mature (guide))
    8. Chrysemys picta cpi-miR-206-3p
    9. Columba livia cli-miR-206-3p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-206
    11. Cyprinus carpio (common carp) ccr-miR-206
    12. Danio rerio dre-miR-206-3p
    13. Dasypus novemcinctus dno-miR-206-3p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1-P3_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-206
    16. Gadus morhua gmo-miR-206-3p
    17. Gallus gallus gga-miR-206
    18. Gorilla gorilla (western gorilla) ggo-miR-206
    19. Haplochromis burtoni abu-miR-206
    20. Ictalurus punctatus (channel catfish) ipu-miR-206
    21. Macaca mulatta (Rhesus monkey) mml-miR-206
    22. Macaca nemestrina (pig-tailed macaque) mne-miR-206
    23. Maylandia zebra (zebra mbuna) mze-miR-206
    24. Monodelphis domestica Mdo-Mir-1-P3_3p (mature (guide))
    25. Mus musculus mmu-miR-206-3p
    26. Neolamprologus brichardi nbr-miR-206
    27. Ophiophagus hannah (king cobra) oha-miR-206
    28. Oreochromis niloticus (Nile tilapia) oni-miR-206
    29. Ornithorhynchus anatinus (platypus) oan-miR-206-3p
    30. Oryctolagus cuniculus (rabbit) ocu-miR-206-3p
    31. Ovis aries Pri-miR206
    32. Pan troglodytes ptr-miR-206
    33. Paralichthys olivaceus pol-miR-206-3p
    34. Pongo pygmaeus ppy-miR-206
    35. Pteropus alecto pal-miR-206-3p
    36. Pundamilia nyererei pny-miR-206
    37. Python bivittatus pbv-miR-206-3p
    38. Rattus norvegicus (Norway rat) rno-miR-206-3p
    39. Salmo salar (Atlantic salmon) ssa-miR-206-3p
    40. Sarcophilus harrisii Sha-Mir-1-P3_3p (mature (guide))
    41. Taeniopygia guttata Tgu-Mir-1-P3_3p (mature (guide))
    42. Tor tambroides miR-206-3p
    43. Xenopus laevis xla-miR-206-3p
    44. Xenopus tropicalis xtr-miR-206