Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-206 URS000034B6F5_9593

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gorilla gorilla. Annotated by 2 databases (RefSeq, miRBase). Described in 3 papers. Gorilla gorilla (western gorilla) ggo-miR-206 sequence is a product of miR-206, ggo-miR-206, MIR206 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAAUGUAAGGAAGUGUGUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 75 other species

    1. Alligator mississippiensis ami-miR-206-3p
    2. Anolis carolinensis Aca-Mir-1-P3_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-206
    4. Callithrix jacchus cja-miR-206
    5. Canis lupus familiaris cfa-miR-206
    6. Cavia porcellus (domestic guinea pig) cpo-miR-206-3p
    7. Chrysemys picta bellii Cpi-Mir-1-P3_3p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-206-3p
    9. Columba livia (rock pigeon) cli-miR-206-3p
    10. Cricetulus griseus cgr-miR-206
    11. Cyprinus carpio ccr-miR-206
    12. Danio rerio (zebrafish) dre-miR-206-3p
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-206-3p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1-P3_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-206
    16. Gadus morhua gmo-miR-206-3p
    17. Gallus gallus (chicken) gga-miR-206
    18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-206
    19. Homo sapiens hsa-miR-206
    20. Ictalurus punctatus (channel catfish) ipu-miR-206
    21. Macaca mulatta mml-miR-206
    22. Macaca nemestrina (pig-tailed macaque) mne-miR-206
    23. Maylandia zebra mze-miR-206
    24. Monodelphis domestica Mdo-Mir-1-P3_3p (mature (guide))
    25. Mus musculus (house mouse) mmu-miR-206-3p
    26. Neolamprologus brichardi nbr-miR-206
    27. Ophiophagus hannah oha-miR-206
    28. Oreochromis niloticus oni-miR-206
    29. Ornithorhynchus anatinus oan-miR-206-3p
    30. Oryctolagus cuniculus (rabbit) ocu-miR-206-3p
    31. Ovis aries Pri-miR206
    32. Pan troglodytes (chimpanzee) ptr-miR-206
    33. Paralichthys olivaceus (Japanese flounder) pol-miR-206-3p
    34. Pongo pygmaeus ppy-miR-206
    35. Pteropus alecto pal-miR-206-3p
    36. Pundamilia nyererei pny-miR-206
    37. Python bivittatus pbv-miR-206-3p
    38. Rattus norvegicus rno-miR-206-3p
    39. Salmo salar (Atlantic salmon) ssa-miR-206-3p
    40. Sarcophilus harrisii Sha-Mir-1-P3_3p (mature (guide))
    41. Taeniopygia guttata (zebra finch) Tgu-Mir-1-P3_3p (mature (guide))
    42. Tor tambroides miR-206-3p
    43. Xenopus laevis (African clawed frog) xla-miR-206-3p
    44. Xenopus tropicalis xtr-miR-206