Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-206 URS000034B6F5_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-206: gga-mir-206 is a muscle-specific miRNA that has been identified in chickens [PMC7797159]. It has been found to affect preadipocyte proliferation and differentiation in chickens [PMC9258119]. The overexpression of gga-mir-206 inhibits adipogenesis by downregulating its target gene, Kruppel-like factor 4 (KLF4) [PMC9258119]. gga-mir-206 has also been found to be differentially expressed in embryonic skeletal muscle tissues between meat-type broilers and egg-type layer chickens [PMC4849015]. It is the most abundant miRNA in skeletal muscles of broilers and layers, consistent with its role in skeletal muscle development [PMC3107184]. gga-mir-206 has also been identified as a target of circRNA derived from the RBFOX2 gene [PMC5824844]. It is associated with genes such as ankyrin repeat domain 1 (ANKRD1), ankyrin repeat domain 12 (ANKRD12), MAFF, FOS, osteocalcin-like protein OC3 (OC3), phytate kinase 2 (IP6K2), and Cyclin C (CCNC) [PMC9689937]. The expression of gga-mir-206 is downregulated by miR-M2-5p, resulting in the upregulation of Pax3, Bcl-2, and Bcl-xL and inhibition of CEF cell apoptosis [PMC7669912]. The expression of gga-mir-206 has also been confirmed by real-time RT-PCR [PMC3496578]. In addition to its role in muscle development, gga-mir-206 has also been found to target the FoxO signaling pathway and the MAPK signaling pathway in chickens [PMC6815035].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAGGAAGUGUGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-206-3p
  2. Anolis carolinensis (green anole) Aca-Mir-1-P2_3p (mature (guide))
  3. Bos taurus (cattle) bta-miR-206
  4. Callithrix jacchus cja-miR-206
  5. Canis lupus familiaris (dog) cfa-miR-206
  6. Cavia porcellus (domestic guinea pig) cpo-miR-206-3p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P2_3p (mature (guide))
  8. Chrysemys picta (Painted turtle) cpi-miR-206-3p
  9. Columba livia cli-miR-206-3p
  10. Cricetulus griseus cgr-miR-206
  11. Cyprinus carpio (common carp) ccr-miR-206
  12. Danio rerio dre-miR-206-3p
  13. Dasypus novemcinctus dno-miR-206-3p
  14. Echinops telfairi Ete-Mir-1-P2_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-206
  16. Gadus morhua gmo-miR-206-3p
  17. Gekko japonicus Gja-Mir-1-P2f_3p (mature (guide))
  18. Gorilla gorilla gorilla ggo-miR-206 (MIR206)
  19. Gorilla gorilla (western gorilla) ggo-miR-206
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-206
  21. Homo sapiens hsa-miR-206
  22. Ictalurus punctatus ipu-miR-206
  23. Latimeria chalumnae Lch-Mir-1-P2_3p (mature (guide))
  24. Lepisosteus oculatus Loc-Mir-1-P2_3p (mature (guide))
  25. Macaca mulatta mml-miR-206
  26. Macaca nemestrina mne-miR-206
  27. Maylandia zebra (zebra mbuna) mze-miR-206
  28. Microcaecilia unicolor Mun-Mir-1-P2_3p (mature (guide))
  29. Monodelphis domestica Mdo-Mir-1-P2_3p (mature (guide))
  30. Monopterus albus Mal-Mir-1-P2a_3p (mature (guide))
  31. Mus musculus mmu-miR-206-3p
  32. Neolamprologus brichardi nbr-miR-206
  33. Ophiophagus hannah (king cobra) oha-miR-206
  34. Oreochromis niloticus oni-miR-206
  35. Ornithorhynchus anatinus (platypus) oan-miR-206-3p
  36. Oryctolagus cuniculus ocu-miR-206-3p
  37. Ovis aries Pri-miR206
  38. Pan troglodytes ptr-miR-206
  39. Paralichthys olivaceus pol-miR-206-3p
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-206
  41. Pteropus alecto (black flying fox) pal-miR-206-3p
  42. Pundamilia nyererei pny-miR-206
  43. Python bivittatus (Burmese python) pbv-miR-206-3p
  44. Rattus norvegicus rno-miR-206-3p
  45. Salmo salar ssa-miR-206-3p
  46. Sarcophilus harrisii Sha-Mir-1-P2_3p (mature (guide))
  47. Sphenodon punctatus Spt-Mir-1-P2_3p (mature (guide))
  48. Taeniopygia guttata Tgu-Mir-1-P2_3p (mature (guide))
  49. Tetraodon nigroviridis Tni-Mir-1-P2a_3p (mature (guide))
  50. Tor tambroides (Thai mahseer) miR-206-3p
  51. Xenopus laevis (African clawed frog) xla-miR-206-3p
  52. Xenopus tropicalis xtr-miR-206
Publications