Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-206 URS000034B6F5_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAGGAAGUGUGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-206-3p
  2. Anolis carolinensis (green anole) Aca-Mir-1-P2_3p (mature (guide))
  3. Bos taurus (cattle) bta-miR-206
  4. Callithrix jacchus cja-miR-206
  5. Canis lupus familiaris (dog) cfa-miR-206
  6. Cavia porcellus (domestic guinea pig) cpo-miR-206-3p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P2_3p (mature (guide))
  8. Chrysemys picta (Painted turtle) cpi-miR-206-3p
  9. Columba livia cli-miR-206-3p
  10. Cricetulus griseus cgr-miR-206
  11. Cyprinus carpio (common carp) ccr-miR-206
  12. Danio rerio dre-miR-206-3p
  13. Dasypus novemcinctus dno-miR-206-3p
  14. Echinops telfairi Ete-Mir-1-P2_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-206
  16. Gadus morhua gmo-miR-206-3p
  17. Gallus gallus (chicken) gga-miR-206
  18. Gekko japonicus Gja-Mir-1-P2f_3p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-206 (MIR206)
  20. Gorilla gorilla (western gorilla) ggo-miR-206
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-206
  22. Homo sapiens hsa-miR-206
  23. Ictalurus punctatus ipu-miR-206
  24. Latimeria chalumnae Lch-Mir-1-P2_3p (mature (guide))
  25. Lepisosteus oculatus Loc-Mir-1-P2_3p (mature (guide))
  26. Macaca mulatta mml-miR-206
  27. Macaca nemestrina mne-miR-206
  28. Maylandia zebra (zebra mbuna) mze-miR-206
  29. Microcaecilia unicolor Mun-Mir-1-P2_3p (mature (guide))
  30. Monodelphis domestica Mdo-Mir-1-P2_3p (mature (guide))
  31. Monopterus albus Mal-Mir-1-P2a_3p (mature (guide))
  32. Mus musculus mmu-miR-206-3p
  33. Neolamprologus brichardi nbr-miR-206
  34. Ophiophagus hannah (king cobra) oha-miR-206
  35. Oreochromis niloticus oni-miR-206
  36. Ornithorhynchus anatinus (platypus) oan-miR-206-3p
  37. Oryctolagus cuniculus ocu-miR-206-3p
  38. Ovis aries Pri-miR206
  39. Pan troglodytes ptr-miR-206
  40. Paralichthys olivaceus pol-miR-206-3p
  41. Pongo pygmaeus (Bornean orangutan) ppy-miR-206
  42. Pteropus alecto (black flying fox) pal-miR-206-3p
  43. Pundamilia nyererei pny-miR-206
  44. Python bivittatus (Burmese python) pbv-miR-206-3p
  45. Rattus norvegicus rno-miR-206-3p
  46. Salmo salar ssa-miR-206-3p
  47. Sarcophilus harrisii Sha-Mir-1-P2_3p (mature (guide))
  48. Sphenodon punctatus Spt-Mir-1-P2_3p (mature (guide))
  49. Taeniopygia guttata Tgu-Mir-1-P2_3p (mature (guide))
  50. Tetraodon nigroviridis Tni-Mir-1-P2a_3p (mature (guide))
  51. Tor tambroides (Thai mahseer) miR-206-3p
  52. Xenopus laevis (African clawed frog) xla-miR-206-3p
Publications