v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-206-3p URS000034B6F5_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (ENA, RefSeq, miRBase, MirGeneDB). Danio rerio (zebrafish) dre-miR-206-3p sequence is a product of mir206-2, miR-206, dre-miR-206, mir206-1, dre-miR-206-3p, miR-206-3p genes. Found in the Danio rerio reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGGAAUGUAAGGAAGUGUGUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 51 other species

    1. Alligator mississippiensis ami-miR-206-3p
    2. Anolis carolinensis (green anole) Aca-Mir-1-P2_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-206
    4. Callithrix jacchus cja-miR-206
    5. Canis lupus familiaris (dog) cfa-miR-206
    6. Cavia porcellus (domestic guinea pig) cpo-miR-206-3p
    7. Chrysemys picta bellii Cpi-Mir-1-P2_3p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-206-3p
    9. Columba livia cli-miR-206-3p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-206
    11. Cyprinus carpio (common carp) ccr-miR-206
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-206-3p
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1-P2_3p (mature (guide))
    14. Equus caballus eca-miR-206
    15. Gadus morhua gmo-miR-206-3p
    16. Gallus gallus gga-miR-206
    17. Gekko japonicus Gja-Mir-1-P2f_3p (mature (guide))
    18. Gorilla gorilla ggo-miR-206
    19. Haplochromis burtoni abu-miR-206
    20. Homo sapiens (human) hsa-miR-206
    21. Ictalurus punctatus (channel catfish) ipu-miR-206
    22. Latimeria chalumnae (coelacanth) Lch-Mir-1-P2_3p (mature (guide))
    23. Lepisosteus oculatus Loc-Mir-1-P2_3p (mature (guide))
    24. Macaca mulatta (Rhesus monkey) mml-miR-206
    25. Macaca nemestrina mne-miR-206
    26. Maylandia zebra (zebra mbuna) mze-miR-206
    27. Microcaecilia unicolor Mun-Mir-1-P2_3p (mature (guide))
    28. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-1-P2_3p (mature (guide))
    29. Monopterus albus Mal-Mir-1-P2a_3p (mature (guide))
    30. Mus musculus mmu-miR-206-3p
    31. Neolamprologus brichardi nbr-miR-206
    32. Ophiophagus hannah oha-miR-206
    33. Oreochromis niloticus oni-miR-206
    34. Ornithorhynchus anatinus oan-miR-206-3p
    35. Oryctolagus cuniculus ocu-miR-206-3p
    36. Ovis aries Pri-miR206
    37. Pan troglodytes ptr-miR-206
    38. Paralichthys olivaceus pol-miR-206-3p
    39. Pongo pygmaeus (Bornean orangutan) ppy-miR-206
    40. Pteropus alecto (black flying fox) pal-miR-206-3p
    41. Pundamilia nyererei pny-miR-206
    42. Python bivittatus pbv-miR-206-3p
    43. Rattus norvegicus (Norway rat) rno-miR-206-3p
    44. Salmo salar (Atlantic salmon) ssa-miR-206-3p
    45. Sarcophilus harrisii Sha-Mir-1-P2_3p (mature (guide))
    46. Sphenodon punctatus (tuatara) Spt-Mir-1-P2_3p (mature (guide))
    47. Taeniopygia guttata Tgu-Mir-1-P2_3p (mature (guide))
    48. Tetraodon nigroviridis Tni-Mir-1-P2a_3p (mature (guide))
    49. Tor tambroides miR-206-3p
    50. Xenopus laevis xla-miR-206-3p
    51. Xenopus tropicalis (tropical clawed frog) xtr-miR-206
     Publications