Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-206-3p URS000034B6F5_7955

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAGGAAGUGUGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis ami-miR-206-3p
  2. Anolis carolinensis Aca-Mir-1-P2_3p (mature (guide))
  3. Bos taurus bta-miR-206
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-206
  5. Canis lupus familiaris (dog) cfa-miR-206
  6. Cavia porcellus cpo-miR-206-3p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P2_3p (mature (guide))
  8. Chrysemys picta (Painted turtle) cpi-miR-206-3p
  9. Columba livia (rock pigeon) cli-miR-206-3p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-206
  11. Cyprinus carpio (common carp) ccr-miR-206
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-206-3p
  13. Echinops telfairi Ete-Mir-1-P2_3p (mature (guide))
  14. Equus caballus (horse) eca-miR-206
  15. Gadus morhua (Atlantic cod) gmo-miR-206-3p
  16. Gallus gallus (chicken) gga-miR-206
  17. Gekko japonicus Gja-Mir-1-P2f_3p (mature (guide))
  18. Gorilla gorilla gorilla ggo-miR-206 (MIR206)
  19. Gorilla gorilla ggo-miR-206
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-206
  21. Homo sapiens hsa-miR-206
  22. Ictalurus punctatus (channel catfish) ipu-miR-206
  23. Latimeria chalumnae Lch-Mir-1-P2_3p (mature (guide))
  24. Lepisosteus oculatus (spotted gar) Loc-Mir-1-P2_3p (mature (guide))
  25. Macaca mulatta mml-miR-206
  26. Macaca nemestrina mne-miR-206
  27. Maylandia zebra (zebra mbuna) mze-miR-206
  28. Microcaecilia unicolor Mun-Mir-1-P2_3p (mature (guide))
  29. Monodelphis domestica Mdo-Mir-1-P2_3p (mature (guide))
  30. Monopterus albus (swamp eel) Mal-Mir-1-P2a_3p (mature (guide))
  31. Mus musculus (house mouse) mmu-miR-206-3p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-206
  33. Ophiophagus hannah (king cobra) oha-miR-206
  34. Oreochromis niloticus oni-miR-206
  35. Ornithorhynchus anatinus (platypus) oan-miR-206-3p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-206-3p
  37. Ovis aries Pri-miR206
  38. Pan troglodytes ptr-miR-206
  39. Paralichthys olivaceus (Japanese flounder) pol-miR-206-3p
  40. Pongo pygmaeus ppy-miR-206
  41. Pteropus alecto (black flying fox) pal-miR-206-3p
  42. Pundamilia nyererei pny-miR-206
  43. Python bivittatus (Burmese python) pbv-miR-206-3p
  44. Rattus norvegicus rno-miR-206-3p
  45. Salmo salar (Atlantic salmon) ssa-miR-206-3p
  46. Sarcophilus harrisii Sha-Mir-1-P2_3p (mature (guide))
  47. Sphenodon punctatus Spt-Mir-1-P2_3p (mature (guide))
  48. Taeniopygia guttata Tgu-Mir-1-P2_3p (mature (guide))
  49. Tetraodon nigroviridis Tni-Mir-1-P2a_3p (mature (guide))
  50. Tor tambroides miR-206-3p
  51. Xenopus laevis (African clawed frog) xla-miR-206-3p
  52. Xenopus tropicalis xtr-miR-206
Publications