Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Maylandia zebra (zebra mbuna) mze-miR-206 URS000034B6F5_106582

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Maylandia zebra. Annotated by 1 database (miRBase). Found in the zebra mbuna reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGAAUGUAAGGAAGUGUGUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 51 other species

    1. Alligator mississippiensis ami-miR-206-3p
    2. Anolis carolinensis (green anole) Aca-Mir-1-P2_3p (mature (guide))
    3. Bos taurus (cattle) bta-miR-206
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-206
    5. Canis lupus familiaris (dog) cfa-miR-206
    6. Cavia porcellus cpo-miR-206-3p
    7. Chrysemys picta bellii Cpi-Mir-1-P2_3p (mature (guide))
    8. Chrysemys picta cpi-miR-206-3p
    9. Columba livia (rock pigeon) cli-miR-206-3p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-206
    11. Cyprinus carpio ccr-miR-206
    12. Danio rerio dre-miR-206-3p
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-206-3p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1-P2_3p (mature (guide))
    15. Equus caballus eca-miR-206
    16. Gadus morhua (Atlantic cod) gmo-miR-206-3p
    17. Gallus gallus gga-miR-206
    18. Gekko japonicus Gja-Mir-1-P2f_3p (mature (guide))
    19. Gorilla gorilla ggo-miR-206
    20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-206
    21. Homo sapiens (human) hsa-miR-206
    22. Ictalurus punctatus (channel catfish) ipu-miR-206
    23. Latimeria chalumnae Lch-Mir-1-P2_3p (mature (guide))
    24. Lepisosteus oculatus Loc-Mir-1-P2_3p (mature (guide))
    25. Macaca mulatta mml-miR-206
    26. Macaca nemestrina (pig-tailed macaque) mne-miR-206
    27. Microcaecilia unicolor Mun-Mir-1-P2_3p (mature (guide))
    28. Monodelphis domestica Mdo-Mir-1-P2_3p (mature (guide))
    29. Monopterus albus (swamp eel) Mal-Mir-1-P2a_3p (mature (guide))
    30. Mus musculus mmu-miR-206-3p
    31. Neolamprologus brichardi nbr-miR-206
    32. Ophiophagus hannah oha-miR-206
    33. Oreochromis niloticus oni-miR-206
    34. Ornithorhynchus anatinus (platypus) oan-miR-206-3p
    35. Oryctolagus cuniculus ocu-miR-206-3p
    36. Ovis aries Pri-miR206
    37. Pan troglodytes (chimpanzee) ptr-miR-206
    38. Paralichthys olivaceus pol-miR-206-3p
    39. Pongo pygmaeus (Bornean orangutan) ppy-miR-206
    40. Pteropus alecto (black flying fox) pal-miR-206-3p
    41. Pundamilia nyererei pny-miR-206
    42. Python bivittatus (Burmese python) pbv-miR-206-3p
    43. Rattus norvegicus rno-miR-206-3p
    44. Salmo salar (Atlantic salmon) ssa-miR-206-3p
    45. Sarcophilus harrisii Sha-Mir-1-P2_3p (mature (guide))
    46. Sphenodon punctatus (tuatara) Spt-Mir-1-P2_3p (mature (guide))
    47. Taeniopygia guttata (zebra finch) Tgu-Mir-1-P2_3p (mature (guide))
    48. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-1-P2a_3p (mature (guide))
    49. Tor tambroides miR-206-3p
    50. Xenopus laevis (African clawed frog) xla-miR-206-3p
    51. Xenopus tropicalis xtr-miR-206