Homo sapiens (human) hsa-miR-9-3p URS00003496BE_9606

• 22 nucleotides
• 8 databases (ENA, GeneCards, IntAct, LncBase, MalaCards, miRBase, RefSeq, TarBase)
• Found in 8 other species
• 537 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

mRNA interactions 6 total

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AUAAAGCUAGAUAACCGAAAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

1. Macaca mulatta mml-miR-9-3-3p
2. Monodelphis domestica (gray short-tailed opossum) mdo-miR-9a-3p
3. Mus musculus mmu-miR-9-3p
4. Pteropus alecto pal-miR-9-3p
5. Rattus norvegicus (Norway rat) rno-miR-9a-3p
6. Salmo salar ssa-miR-9a-4-3p
7. Taeniopygia guttata tgu-miR-9-3p
8. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-4328524

Publications Download

• FASTA
• JSON