Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-9-3p URS00003496BE_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MalaCards, ENA, LncBase, IntAct, RefSeq, miRBase, GeneCards, MirGeneDB, TarBase). Described in 105 papers. Homo sapiens (human) hsa-miR-9-3p sequence is a product of hsa-miR-9-3p, miR-9-3p, MIR9-1, miR-9, hsa-miR-9, MIR9-2, MIR9-3 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 182-FIP, 239FB, 3-PAP, 3D3, 3PAP, 4832404P21Rik, 4833431A01Rik, 80K-L, 82-FIP.

Interactions 4

According to IntAct, Homo sapiens (human) hsa-miR-9-3p interacts with:

IntAct ID Participant Synonyms
EBI-20798060 intact:EBI-20798051 EBI-20798051 ENST00000465804 mrna_taz
EBI-20812631 intact:EBI-20812634 EBI-20812634 ENST00000622132 mrna_abcb1
EBI-20813142 intact:EBI-20813190 EBI-20813190 ENST00000439977 mrna_herpud1
EBI-26609925 intact:EBI-26609928 EBI-26609928 ENST00000302278 mrna_itgb1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUAAAGCUAGAUAACCGAAAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species