Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-1a-3p URS0000348947_9031

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Gallus gallus. Annotated by 3 databases (miRBase, RefSeq, ENA). Described in 6 papers. Gallus gallus (chicken) gga-miR-1a-3p sequence is a product of MIR1-1, MIR1-2, gga-miR-1a, miR-1a-3p, miR-1a, gga-miR-1a-3p, miR-1 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAAUGUAAAGAAGUAUGUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 132 other species

    1. Ascaris suum asu-miR-1-3p
    2. Caenorhabditis brenneri cbn-miR-1
    3. Caenorhabditis briggsae cbr-miR-1
    4. Caenorhabditis elegans cel-miR-1-3p
    5. Callorhinchus milii cmi-miR-1-3
    6. Canis lupus familiaris (dog) cfa-miR-1
    7. Danio rerio microRNA miR-1
    8. Gorilla gorilla ggo-miR-1
    9. Heligmosomoides polygyrus hpo-miR-1-3p
    10. Mus musculus Mus_musculus piRNA piR-mmu-34030223
    11. Oryzias latipes (Japanese medaka) ola-miR-1-3p
    12. Ovis aries Pri-miR1.2
    13. Pan paniscus (pygmy chimpanzee) ppa-miR-1
    14. Pan troglodytes (chimpanzee) microRNA miR-1-2
    15. Python bivittatus (Burmese python) pbv-miR-1a-3p
    16. Scyliorhinus torazame (cloudy catshark) Sto-Mir-1-P4_3p (mature (guide))
    17. Sus scrofa (pig) ssc-miR-1
    18. Xenopus tropicalis xtr-miR-1a
    Publications New