Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS0000346AFC_559292

Automated summary: This snoRNA sequence is 86 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (SGD, RefSeq, Rfam, ENA, IntAct). Described in 31 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snosnR54, RF00473). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR54 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 4

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11793458 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast
EBI-15097638 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast
EBI-16632050 P38996 D6W3H8 EBI-11776 HMD1 NAB3 P38996 Q07034 YPL190C nab3_yeast
EBI-16632058 P53617 D6W0U2 EBI-12228 N0868 NRD1 P53617 YNL251C nrd1_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAGAUGAUGAUCAACUUUUUAUAUCAAUAACUUUCGUUCUACUGACUGUGAUCAAACGAUCUUGUAGAGAACUUUUACUCUGAAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 97 other species

    1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR54
    2. Saccharomyces cerevisiae EC1118 SNR54
    3. Saccharomyces cerevisiae FostersB Small nucleolar RNA snR54
    4. Saccharomyces cerevisiae FostersO Small nucleolar RNA snR54
    5. Saccharomyces cerevisiae Kyokai no. 7 K7_snR54
    6. Saccharomyces cerevisiae Lalvin QA23 Small nucleolar RNA snR54
    7. Saccharomyces cerevisiae P301 SNR54
    8. Saccharomyces cerevisiae PE-2 SNR54
    9. Saccharomyces cerevisiae Vin13 Small nucleolar RNA snR54
    10. Saccharomyces cerevisiae VL3 Small nucleolar RNA snR54
    11. Saccharomyces cerevisiae YJM1078 SNR54
    12. Saccharomyces cerevisiae YJM1083 SNR54
    13. Saccharomyces cerevisiae YJM1129 SNR54
    14. Saccharomyces cerevisiae YJM1133 SNR54
    15. Saccharomyces cerevisiae YJM1190 SNR54
    16. Saccharomyces cerevisiae YJM1199 SNR54
    17. Saccharomyces cerevisiae YJM1202 SNR54
    18. Saccharomyces cerevisiae YJM1208 SNR54
    19. Saccharomyces cerevisiae YJM1242 SNR54
    20. Saccharomyces cerevisiae YJM1244 SNR54
    21. Saccharomyces cerevisiae YJM1248 SNR54
    22. Saccharomyces cerevisiae YJM1250 SNR54
    23. Saccharomyces cerevisiae YJM1252 SNR54
    24. Saccharomyces cerevisiae YJM1304 SNR54
    25. Saccharomyces cerevisiae YJM1307 SNR54
    26. Saccharomyces cerevisiae YJM1311 SNR54
    27. Saccharomyces cerevisiae YJM1326 SNR54
    28. Saccharomyces cerevisiae YJM1336 SNR54
    29. Saccharomyces cerevisiae YJM1338 SNR54
    30. Saccharomyces cerevisiae YJM1341 SNR54
    31. Saccharomyces cerevisiae YJM1342 SNR54
    32. Saccharomyces cerevisiae YJM1355 SNR54
    33. Saccharomyces cerevisiae YJM1381 SNR54
    34. Saccharomyces cerevisiae YJM1383 SNR54
    35. Saccharomyces cerevisiae YJM1385 SNR54
    36. Saccharomyces cerevisiae YJM1386 SNR54
    37. Saccharomyces cerevisiae YJM1387 SNR54
    38. Saccharomyces cerevisiae YJM1388 SNR54
    39. Saccharomyces cerevisiae YJM1389 SNR54
    40. Saccharomyces cerevisiae YJM1399 SNR54
    41. Saccharomyces cerevisiae YJM1400 SNR54
    42. Saccharomyces cerevisiae YJM1401 SNR54
    43. Saccharomyces cerevisiae YJM1402 SNR54
    44. Saccharomyces cerevisiae YJM1415 SNR54
    45. Saccharomyces cerevisiae YJM1417 SNR54
    46. Saccharomyces cerevisiae YJM1418 SNR54
    47. Saccharomyces cerevisiae YJM1419 SNR54
    48. Saccharomyces cerevisiae YJM1433 SNR54
    49. Saccharomyces cerevisiae YJM1439 SNR54
    50. Saccharomyces cerevisiae YJM1443 SNR54
    51. Saccharomyces cerevisiae YJM1444 SNR54
    52. Saccharomyces cerevisiae YJM1447 SNR54
    53. Saccharomyces cerevisiae YJM1450 SNR54
    54. Saccharomyces cerevisiae YJM1460 SNR54
    55. Saccharomyces cerevisiae YJM1463 SNR54
    56. Saccharomyces cerevisiae YJM1477 SNR54
    57. Saccharomyces cerevisiae YJM1478 SNR54
    58. Saccharomyces cerevisiae YJM1479 SNR54
    59. Saccharomyces cerevisiae YJM1527 SNR54
    60. Saccharomyces cerevisiae YJM1549 SNR54
    61. Saccharomyces cerevisiae YJM1573 SNR54
    62. Saccharomyces cerevisiae YJM1574 SNR54
    63. Saccharomyces cerevisiae YJM1592 SNR54
    64. Saccharomyces cerevisiae YJM1615 SNR54
    65. Saccharomyces cerevisiae YJM193 SNR54
    66. Saccharomyces cerevisiae YJM195 SNR54
    67. Saccharomyces cerevisiae YJM244 SNR54
    68. Saccharomyces cerevisiae YJM248 SNR54
    69. Saccharomyces cerevisiae YJM270 SNR54
    70. Saccharomyces cerevisiae YJM271 SNR54
    71. Saccharomyces cerevisiae YJM320 SNR54
    72. Saccharomyces cerevisiae YJM326 SNR54
    73. Saccharomyces cerevisiae YJM428 SNR54
    74. Saccharomyces cerevisiae YJM450 SNR54
    75. Saccharomyces cerevisiae YJM451 SNR54
    76. Saccharomyces cerevisiae YJM453 SNR54
    77. Saccharomyces cerevisiae YJM456 SNR54
    78. Saccharomyces cerevisiae YJM470 SNR54
    79. Saccharomyces cerevisiae YJM541 SNR54
    80. Saccharomyces cerevisiae YJM554 SNR54
    81. Saccharomyces cerevisiae YJM555 SNR54
    82. Saccharomyces cerevisiae YJM627 SNR54
    83. Saccharomyces cerevisiae YJM681 SNR54
    84. Saccharomyces cerevisiae YJM682 SNR54
    85. Saccharomyces cerevisiae YJM683 SNR54
    86. Saccharomyces cerevisiae YJM689 SNR54
    87. Saccharomyces cerevisiae YJM693 SNR54
    88. Saccharomyces cerevisiae YJM969 SNR54
    89. Saccharomyces cerevisiae YJM972 SNR54
    90. Saccharomyces cerevisiae YJM975 SNR54
    91. Saccharomyces cerevisiae YJM978 SNR54
    92. Saccharomyces cerevisiae YJM981 SNR54
    93. Saccharomyces cerevisiae YJM984 SNR54
    94. Saccharomyces cerevisiae YJM987 SNR54
    95. Saccharomyces cerevisiae YJM990 SNR54
    96. Saccharomyces cerevisiae YJM993 SNR54
    97. Saccharomyces cerevisiae YJM996 SNR54
    2D structure New