Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) transfer RNA:Glycine-GCC 1-11 (multiple genes) secondary structure diagram

Drosophila melanogaster (fruit fly) transfer RNA:Glycine-GCC 1-11 (multiple genes) URS00003429B0_7227

Automated summary: This tRNA sequence is 71 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (ENA, FlyBase, Rfam, GtRNAdb). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Drosophila melanogaster (fruit fly) transfer RNA:Glycine-GCC 1-11 (multiple genes) sequence is a product of FBgn0011862, FBgn0011867, tRNA-Gly-GCC-1-8, tRNA:Gly-GCC-1-12, FBgn0011863, tRNA:Gly-GCC-1-4, tRNA:Gly-GCC-1-5, tRNA:Gly-GCC-1-6, tRNA:Gly-GCC-1-11, tRNA:Gly-GCC-1-7, tRNA-Gly-GCC-1-2, tRNA:Gly-GCC-1-13, FBgn0011870, tRNA-Gly-GCC-1-3, tRNA:Gly-GCC-1-2, tRNA:Gly-GCC-1-8, tRNA-Gly-GCC-1-13, tRNA-Gly-GCC-1-9, tRNA-Gly-GCC-1-12, FBgn0011859, tRNA:Gly-GCC-1-9, tRNA-Gly-GCC-1-11, FBgn0011868, FBgn0011861, FBgn0011871, tRNA-Gly-GCC-1-7, tRNA:Gly-GCC-1-10, tRNA-Gly-GCC-1-10, tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-4, FBgn0011872, tRNA:Gly-GCC-1-3, tRNA-Gly-GCC-1-6, FBgn0011864, tRNA-Gly-GCC-1-5, FBgn0011869, FBgn0011860, FBgn0011865, tRNA:Gly-GCC-1-1 genes. Found in the fruit fly reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GCAUCGGUGGUUCAGUGGUAGAAUGCUCGCCUGCCACGCGGGCGGCCCGGGUUCGAUUCCCGGCCGAUGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 1,928 other species

    1. Acromyrmex echinatior tRNA
    2. Aedes aegypti misc RNA AAEL028939.1
    3. Aedes albopictus misc RNA tRNA-Gly
    4. Agrilus planipennis (emerald ash borer) tRNA
    5. Ancylostoma caninum (dog hookworm) tRNA-Gly
    6. Ancylostoma ceylanicum tRNA
    7. Ancylostoma duodenale tRNA
    8. Anisakis simplex tRNA
    9. Anopheles albimanus tRNA
    10. Anopheles arabiensis misc RNA tRNA-Gly
    11. Anopheles atroparvus tRNA-Gly for anticodon GCC
    12. Anopheles christyi misc RNA tRNA-Gly
    13. Anopheles coluzzii tRNA-Gly for anticodon GCC
    14. Anopheles culicifacies misc RNA tRNA-Gly
    15. Anopheles darlingi misc RNA ADAC010736.1
    16. Anopheles dirus misc RNA tRNA-Gly
    17. Anopheles epiroticus misc RNA tRNA-Gly
    18. Anopheles farauti misc RNA tRNA-Gly
    19. Anopheles funestus tRNA-Gly for anticodon GCC
    20. Anopheles gambiae misc RNA tRNA-Gly
    21. Anopheles gambiae str. PEST tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    22. Anopheles maculatus misc RNA tRNA-Gly
    23. Anopheles melas misc RNA tRNA-Gly
    24. Anopheles merus misc RNA tRNA-Gly
    25. Anopheles minimus misc RNA tRNA-Gly
    26. Anopheles quadriannulatus misc RNA tRNA-Gly
    27. Anopheles sinensis misc RNA tRNA-Gly
    28. Anopheles stephensi misc RNA tRNA-Gly
    29. Anoplophora glabripennis tRNA-Gly for anticodon GCC
    30. Apis mellifera tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 6)
    31. Arabis alpina tRNA
    32. Araneus ventricosus tRNA-Gly
    33. Atta cephalotes (leaf-cutter ant) tRNA LOC105616975-2
    34. Atta colombica tRNA
    35. Blattella germanica tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 19)
    36. Bombus impatiens tRNA-Gly for anticodon GCC
    37. Bombus terrestris tRNA LOC110119263
    38. Bombyx mori tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 27)
    39. Brugia malayi tRNA Bm14580
    40. Brugia pahangi tRNA
    41. Brugia timori tRNA
    42. Camponotus floridanus tRNA
    43. Capitella teleta (bristle worm) tRNA-Gly for anticodon GCC
    44. Ceratitis capitata tRNA-Gly
    45. Cimex lectularius (bed bug) misc RNA tRNA-Gly
    46. Crassostrea gigas (Pacific oyster) tRNA-Gly for anticodon GCC
    47. Cryptotermes secundus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 4)
    48. Culex quinquefasciatus misc RNA tRNA-Gly
    49. Cyphomyrmex costatus tRNA
    50. Danaus plexippus (monarch butterfly) tRNA-Gly for anticodon GCC
    51. Danaus plexippus plexippus tRNA
    52. Drosophila ananassae tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
    53. Drosophila busckii tRNA
    54. Drosophila erecta tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
    55. Drosophila ficusphila tRNA
    56. Drosophila grimshawi tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 18)
    57. Drosophila guanche tRNA.Gly
    58. Drosophila mojavensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
    59. Drosophila persimilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
    60. Drosophila pseudoobscura pseudoobscura tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 19)
    61. Drosophila sechellia tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 12)
    62. Drosophila simulans tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
    63. Drosophila virilis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
    64. Drosophila willistoni tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 9)
    65. Drosophila yakuba tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
    66. Dufourea novaeangliae tRNA
    67. Eumeta japonica tRNA-Gly
    68. Frieseomelitta varia tRNA-Gly
    69. Glossina austeni misc RNA tRNA-Gly
    70. Glossina brevipalpis misc RNA tRNA-Gly
    71. Glossina fuscipes fuscipes misc RNA tRNA-Gly
    72. Glossina morsitans morsitans misc RNA tRNA-Gly
    73. Glossina pallidipes misc RNA tRNA-Gly
    74. Glossina palpalis gambiensis misc RNA tRNA-Gly
    75. Gongylonema pulchrum tRNA
    76. Habropoda laboriosa tRNA
    77. Haemonchus contortus tRNA
    78. Haemonchus placei tRNA
    79. Harpegnathos saltator tRNA
    80. Heliconius melpomene (postman butterfly) tRNA HMEL012697
    81. Heligmosomoides polygyrus bakeri tRNA
    82. Helobdella robusta (freshwater leech) tRNA-Gly for anticodon GCC
    83. Heterorhabditis bacteriophora tRNA
    84. Lasius niger tRNA
    85. Lingula anatina tRNA-Gly for anticodon GCC
    86. Loa loa tRNA-Gly for anticodon GCC
    87. Lucilia cuprina tRNA-Gly for anticodon GCC
    88. Lupinus angustifolius tRNA
    89. Lutzomyia longipalpis misc RNA tRNA-Gly
    90. Macrostomum lignano tRNA
    91. Megaselia scalaris tRNA-Gly for anticodon GCC
    92. Melipona quadrifasciata tRNA
    93. Musca domestica (house fly) misc RNA MDOA002438.1
    94. Mytilus galloprovincialis tRNA
    95. Nasonia vitripennis tRNA-Gly
    96. Necator americanus tRNA
    97. Trichonephila clavipes tRNA-Gly
    98. Nippostrongylus brasiliensis tRNA
    99. Octopus bimaculoides tRNA
    100. Oesophagostomum dentatum tRNA
    101. Onchocerca flexuosa tRNA-Gly
    102. Onchocerca ochengi tRNA
    103. Onchocerca volvulus tRNA OVOC13063
    104. Ooceraea biroi (clonal raider ant) tRNA
    105. Operophtera brumata (winter moth) tRNA
    106. Oryctes borbonicus tRNA
    107. Papilio machaon tRNA
    108. Papilio xuthus tRNA
    109. Pararge aegeria tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
    110. Pediculus humanus corporis misc RNA tRNA-Gly
    111. Phaseolus vulgaris tRNA
    112. Phlebotomus papatasi misc RNA tRNA-Gly
    113. Plutella xylostella (diamondback moth) tRNA-Gly
    114. Pristionchus pacificus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 24)
    115. Puccinia striiformis f. sp. tritici PST-78 tRNA
    116. Punica granatum tRNA
    117. Rhodnius prolixus misc RNA tRNA-Gly
    118. Solenopsis invicta tRNA-Gly
    119. Spodoptera frugiperda tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    120. Stegodyphus mimosarum tRNA-Gly for anticodon GCC
    121. Steinernema glaseri tRNA
    122. Stomoxys calcitrans tRNA-Gly
    123. Strigamia maritima tRNA-Gly for anticodon GCC
    124. Teladorsagia circumcincta tRNA-Gly
    125. Teleopsis dalmanni tRNA-Gly for anticodon GCC
    126. Thelazia callipaeda tRNA
    127. Trachymyrmex cornetzi tRNA
    128. Trachymyrmex septentrionalis tRNA
    129. Trachymyrmex zeteki tRNA
    130. Tribolium castaneum tRNA-Gly for anticodon GCC
    131. Trichomalopsis sarcophagae tRNA
    132. Trichonephila clavipes tRNA-Gly
    133. uncultured Gammaproteobacteria bacterium transfer RNA
    134. Wuchereria bancrofti tRNA
    135. Zootermopsis nevadensis tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 5)
    2D structure Publications New