Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-30b precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-30b precursor URS00003426E6_9597

88 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 13 other species
74 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACCAAGUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAAUACAUGGAUUGGCUGGGAGGUGGAUGUUUACUUCAGCUGACUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000015716.1)
Chlorocebus sabaeus (African green monkey) microRNA 30b (ENSCSAG00000023559.1)
Colobus angolensis palliatus miRNA (ENSCANG00000007999.1)
Homo sapiens microRNA hsa-mir-30b precursor
Macaca fascicularis (Crab-eating macaque) microRNA 30b (ENSMFAG00000013458.2)
Macaca mulatta (Rhesus monkey) microRNA mml-mir-30b precursor
Macaca nemestrina microRNA mne-mir-30b precursor
Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000010930.1)
Pan troglodytes microRNA ptr-mir-30b precursor
Papio anubis miRNA (ENSPANG00000027068.3)
Piliocolobus tephrosceles miRNA (ENSPTEG00000028015.1)
Pongo abelii miRNA (ENSPPYG00000021874.2)
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-30b precursor

2D structure

Publications