Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-127 precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-127 precursor URS0000341906_10090

Automated summary: This pre miRNA sequence is 70 nucleotides long and is found in Mus musculus. Annotated by 6 databases (RefSeq, miRBase, Ensembl, Ensembl/GENCODE, ENA, MGI). Described in 34 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-127, RF00676). Mus musculus (house mouse) microRNA mmu-mir-127 precursor sequence is a product of Mir127, 127 precursor, mmu-mir-127 precursor, mir-127 precurso, mir-127, 127 precurso, mir-127 precursor, miR-127 precursor genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Cavia aperea (Brazilian guinea pig) microRNA 127
    2. Cavia porcellus microRNA 127
    3. Chinchilla lanigera (Long-tailed chinchilla) microRNA 127
    4. Cricetulus griseus (Chinese hamster) microRNA cgr-mir-127 precursor
    5. Dipodomys ordii miRNA
    6. Equus caballus (horse) microRNA eca-mir-127 precursor
    7. Erinaceus europaeus (western European hedgehog) microRNA 127
    8. Fukomys damarensis (Damara mole rat) miRNA
    9. Heterocephalus glaber microRNA 127
    10. Ictidomys tridecemlineatus microRNA 127
    11. Loxodonta africana microRNA 127
    12. Mesocricetus auratus (Golden Hamster) microRNA 127 (Mir127)
    13. Microtus ochrogaster microRNA 127
    14. Mus caroli microRNA 127
    15. Mus pahari microRNA 127
    16. Mus spretus microRNA 127
    17. Nannospalax galili miRNA
    18. Octodon degus (Degu) miRNA
    19. Otolemur garnettii (small-eared galago) miRNA
    20. Vicugna pacos (alpaca) microRNA 127
    2D structure New