Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-374b-5p URS000033F45D_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MalaCards, GeneCards, PSICQUIC, MirGeneDB, LncBase, RefSeq, miRBase, TarBase, ENA). Described in 46 papers. Homo sapiens (human) hsa-miR-374b-5p sequence is a product of miR-374b-5p, hsa-miR-374b-5p, MIR374B, miR-374, miR-374b, hsa-miR-374b genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 15.5K, 182-FIP, 1R20, 2'-PDE, 21-GARP, 2H9, 3'HEXO, 30ST3B1, 3635, 3D3.

Interactions 2

According to PSICQUIC, Homo sapiens (human) hsa-miR-374b-5p interacts with:

Interaction id Participant Synonyms
URS000033F45D_9606-0 P57087 P57087
URS000033F45D_9606-1 P57087 P57087

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUAUAAUACAACCUGCUAAGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Bos taurus (cattle) bta-miR-374b
    2. Canis lupus familiaris cfa-miR-374b
    3. Capra hircus chi-miR-374b-5p
    4. Cricetulus griseus cgr-miR-374-5p
    5. Equus caballus (horse) eca-miR-374b
    6. Gorilla gorilla (western gorilla) ggo-miR-374b
    7. Macaca mulatta mml-miR-374b-5p
    8. Mus musculus (house mouse) mmu-miR-374b-5p
    9. Oryctolagus cuniculus (rabbit) ocu-miR-374b-5p
    10. Pan troglodytes (chimpanzee) ptr-miR-374b
    11. Pteropus alecto pal-miR-374b-5p
    12. Rattus norvegicus rno-miR-374-5p
    13. Sus scrofa ssc-miR-374b-5p