Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-935 URS000033EBB8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-935: Hsa-mir-935 is a microRNA that is implicated in aiding a definitive diagnosis in various conditions such as Lymphoma and Metastasis, Lymphoma and Glioblastoma, and Lymphoma and Medulloblastoma [PMC4673232]. In addition to hsa-mir-935, two other microRNAs, hsa-miRNA-29b and hsa-miR-96-5p, were exclusively expressed in MVs from ELC [PMC8000192]. Hsa-miRNA-29b is a microRNA that has been associated with epithelial-to-mesenchymal transition (MET) [PMC8000192]. The differential diagnosis between Lymphoma and Metastasis, Lymphoma and Glioblastoma, as well as Lymphoma and Medulloblastoma can be aided by the presence of miR-711 [PMC4673232]. These miRNAs can be used to distinguish between different conditions by their expression patterns. The expression of hsa-mir-935 in particular can provide valuable insights for a definitive diagnosis [PMC4673232]. By analyzing the expression levels of these miRNAs in various conditions, researchers can potentially improve the accuracy of differential diagnoses.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGUUACCGCUUCCGCUACCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Publications